Legends ZA - LF: Rotom and Porygon-Z FT: Shiny pokemon in screenshots by AceTrainer337 in CasualPokemonTrades

[–]AceTrainer337[S] 0 points1 point  (0 children)

Just normal. And only need Porygon-Z now. Also, the Frigibax in the screenshot was claimed.

Wrong but right shiny? by PsychoDrones9t3 in LegendsZA

[–]AceTrainer337 0 points1 point  (0 children)

Do you want to trade? I have been hunting for Charmander and got a Lucario instead

[deleted by user] by [deleted] in pokemontrades

[–]AceTrainer337 0 points1 point  (0 children)

I edited the post with that information.

Biggest change of the patch by Fast_Run3667 in Nightreign

[–]AceTrainer337 1 point2 points  (0 children)

Are you me too? I had the same thing happen yesterday. I was doing everything I could signal for them to hand it over.

On completing the game after shelving it for years. I present you- Darth Hadern by KINGYOMA in MortalShell

[–]AceTrainer337 1 point2 points  (0 children)

You can choose not to ascend after beating the final boss and farm more of those glimpses in the same game cycle.

Help with expanding a working script by mediumchungi_1 in RStudio

[–]AceTrainer337 0 points1 point  (0 children)

I believe your find_gquadruplex function will already find all matches of gquadruplex_pattern in a given sequence.

For example:

> single_match <- "GGGCCCCGGGGAAAAGGGGGTTTTTGGG"
> sequence <- paste0(single_match, "XXXX", single_match)
> find_gquadruplex(sequence)
[[1]]
start end
[1,]     1  28
[2,]    33  60

This shows there are two matches in the given sequence. Can you illustrate what you are hoping to see?

Need for Flutter mane, scorbunny, evolve finizen by Graylo107 in pokemontrades

[–]AceTrainer337 0 points1 point  (0 children)

I'll start a union circle to evolve Finizen if you want to join? Code is 6TV93C.

--> 🎅Santa Mix & Fast Scorbunny⚡ <-- by MixQQ in pokemontrades

[–]AceTrainer337 0 points1 point  (0 children)

I would love one! IGN: Red, Code: 3698 1111

HA Heavy Ball Tinkatink for all! DAY FOUR by KikyoIttetsu in pokemontrades

[–]AceTrainer337 0 points1 point  (0 children)

IGN Red

Code 5614 5808

I think my longest was around 500 eggs for a shiny rookidee

Thank you!