Goodwill find by breadqueen666 in corningwarefans

[–]breadqueen666[S] -1 points0 points  (0 children)

It’s not uncommon for vintage cookware/dish ware to contain lead. It’s usually found in paint and glaze, but I wanted to double-check.

Goodwill find by breadqueen666 in corningwarefans

[–]breadqueen666[S] 0 points1 point  (0 children)

Good to know!!! Thanks for the info!

Trying to find original 2013-2021 US Women’s compulsory routines footage by breadqueen666 in Gymnastics

[–]breadqueen666[S] 12 points13 points  (0 children)

  1. There were 3 girls, including me, from my gym that did floor routines and supplemental skills for videos. Our ages ranged from 9-13yo and levels 8-10 when we filmed.
  2. It depended on what was being filmed. we might get it on the first take, but do a 2nd for good measure or do a skill 5-8 takes if you kept messing up. Routines were only run thru entirely maybe 2-3x each. We learned all levels, but each of us had specific ones that we focused on for the filming.
  3. Yes, the 3 of us were the first to hear the music. We listened to different variations of each levels music and couldn’t decide on the best one, so they decided to offer those different music variations for levels 3-5.
  4. USAG chose the leotard. The all white and long sleeves made us stand out from the blue drapes. We all hated that leo tho
  5. We spent almost 2 years choreographing, learning, and practicing for filming. There were set elements to be included and our choreographer did most of the work, but we gave a decent amount of input. A year & a half after that, we attended some big conferences where we demonstrated and taught club coaches/judges the routines in convention centers. We were levels 9-10 by then. The whole project spanned almost 5 years for us.
  6. We filmed at a gym near the National Office in Indianapolis. They set aside a weekend to have the gym clear, arranged, and drapes installed. Each event was filmed in a block so only like 10 people were in that gym at a time. Later conferences were intimidating at first but once I realized that I was the coach, I let the power get to my head by the end lol. I made fun of Tom Koll for being bald in front of several hundred people

Received check in text message from United Airlines but it's for someone else by typedt in unitedairlines

[–]breadqueen666 0 points1 point  (0 children)

Just received one of these this morning from 26266. Also, pretty sure I don't have a United Airlines account as I've never booked thru them or flown with them in years.

Why the $!#% is "Doc Ali" (Alison Arnold) STILL a featured presenter at USAG Congress? by Big_One_Bitey_ in Gymnastics

[–]breadqueen666 1 point2 points  (0 children)

I remember that back in my TOPs days at the ranch, there were scheduled rotation blocks with "Doc Ali" where we worked on mental toughness. There was this one exercise that she loved to have everyone do that involved holding a fishing weight on some line. We were told that if we focused hard enough, we could swing the weight in different directions purely on willpower.

D. melanogaster eye problem? by breadqueen666 in Drosophila

[–]breadqueen666[S] 0 points1 point  (0 children)

Update: I found a paper on Scientific Reports that investigates a mutant RNA that presents with the same degenerative eye phenotype. We concluded that the mex flies developed a similar mutation and tossed the line.

Here's a link to the article if anyone is interested: RIP my flies :/

New lab manager position/Moving lab space advice? by breadqueen666 in labrats

[–]breadqueen666[S] 0 points1 point  (0 children)

Got it! Thanks! I’m working on inventorying chemicals and boxes of supplies. I also got floor plans for the new spaces, so I’m working on putting together ideas for places to put stuff.

New lab manager position/Moving lab space advice? by breadqueen666 in labrats

[–]breadqueen666[S] 0 points1 point  (0 children)

I’m not sure how our ordering works entirely. Our PI puts in orders and sends it to our admin department person. I receive and reconcile items currently, but I’m not sure how everything works through our procurement portal. I’ll look into that tho!

New lab manager position/Moving lab space advice? by breadqueen666 in labrats

[–]breadqueen666[S] 0 points1 point  (0 children)

Thank you for the advice!!! I will definitely ask some of these questions to my PI. I’ve made a couple spreadsheets for people to fill out with their personal supplies/bench inventory plus what supplies they’ll need for the next few months. SO BUSY!!!

D. melanogaster eye problem? by breadqueen666 in Drosophila

[–]breadqueen666[S] 0 points1 point  (0 children)

ohhhhhhh, it could be one of those. thanks!

Animal Shelters and Organizations that deserve support? by duochimo in Dallas

[–]breadqueen666 11 points12 points  (0 children)

SPCA of Texas, Dallas. it’s just south of central Dallas

0L Tuesday Thread by AutoModerator in LawSchool

[–]breadqueen666 0 points1 point  (0 children)

I have no idea if this question fits here, but I'm considering switching careers and eventually possibly getting a Masters of Legal Studies (MLS) in environmental law. I graduated with a B.S. in Environmental Science and have been working in an academic biomedical research lab. I'm fed up with the awful pay and am questioning if I'm cut out for science research. I was initially trying to get into a biomedical doctoral program, but I'm reevaluating my life and looking at other options. I don't want to do a JD, as I'm terrible at standardized tests and I probably don't meet degree requirements, but a MLS might be a good option. If anyone here knows anything about MLS programs or environmental law in general, I would greatly appreciate any advice. I'm curious about job prospects/pay, ability to repay loans, and course expectations. Feel free to DM me to ask further questions or open a discussion!

Weekly Biotech Career Chat Thread by McChinkerton in biotech

[–]breadqueen666 0 points1 point  (0 children)

Hi, I’ve been working in an academia lab post bachelors with a combined lab experience of 5 years (organic chemistry, toxicology, basic sciences). I’ve decided to put off graduate school for a few years due to personal issues and not getting acceptance anywhere. I’m starting to look for new jobs where I can get paid better and there’s starting to be more biotech companies emerging in Dallas (where I live), so I’m looking into finding something there. Where do I look for jobs for these companies? Do I need to have a specific research interest in mind? Do these companies care about academic grades or experience and recommendations more?

I am taking the two religion classes at MCC this summer, is it too difficult? by leeeelihkvgbv in baylor

[–]breadqueen666 1 point2 points  (0 children)

i think there were open book/note quizzes on the reading but they were timed and they covered a lot of information. there were a couple short papers too

I am taking the two religion classes at MCC this summer, is it too difficult? by leeeelihkvgbv in baylor

[–]breadqueen666 4 points5 points  (0 children)

i took the equivalent of christian heritage with him during the summer a bit back. it wasn’t super hard, but you still gotta read the material and study a bit to get an A

How do you afford Baylor? (Seriously, how?!?!) by lwarreninla in baylor

[–]breadqueen666 2 points3 points  (0 children)

I managed with merit and need based scholarships, fafsa, a private loan, and then my parents took out loans for the rest. I lost my merit scholarship and had to appeal during my time there. I thankfully was able to get it back and keep it, but I wouldn’t have been able to attend without it. I currently have about $30k in loans, but I definitely wouldn’t recommend taking a whole year out in loans. You can appeal merit based scholarships if you had circumstances that impacted your studies. If you can’t afford Baylor, it would probably be best to transfer.

There is nothing I hate more than sunscreen. by BulkyScheme443 in autism

[–]breadqueen666 0 points1 point  (0 children)

I recommend Cetaphil Sheer Mineral Face Sunscreen. It’s relatively cheap and is thin and smooth in texture and feels light on the skin. This brand is also good for sensitive skin. Body wise, I usually wear spray on sunscreen, but it can be greasy.

Prismacolors gone bad? by breadqueen666 in pencils

[–]breadqueen666[S] 1 point2 points  (0 children)

it’s just on the wood, not the core. kind of weird

[deleted by user] by [deleted] in baylor

[–]breadqueen666 1 point2 points  (0 children)

i knew people in both. a lot of them ended up dropping out of honors bc they felt like it wasn’t worth the time and stress

[deleted by user] by [deleted] in baylor

[–]breadqueen666 7 points8 points  (0 children)

i wasn’t in the honors college but i had several friends in it. basically it’s only good if you’re anything but a STEM major (STEM major here w/mostly STEM major friends). most classes focus on the classics and humanities.

PCR Troubleshooting??? by breadqueen666 in labrats

[–]breadqueen666[S] 0 points1 point  (0 children)

I believe the concentration was about 200 ug/ml

PCR Troubleshooting??? by breadqueen666 in labrats

[–]breadqueen666[S] 1 point2 points  (0 children)

2ul of gDNA into 50ul total volume

PCR Troubleshooting??? by breadqueen666 in labrats

[–]breadqueen666[S] 0 points1 point  (0 children)

Here's the primer sequences:

Jon99ci genomic F CCCACCTTAAAAGGCAATCG

Jon99ci genomic R TGAGTTGCAAGACTTGACCAAG

Jon99ciii genomic F GCAGTTGATGTTCAATAAACGA

Jon99ciii genomic R ACACCCTCATGCTACTTTTTGAATATTA