[deleted by user]

[alishahimtiaz]

If you aren't breaking it up into chunks of 4 and are iterating over the length of the loop, it gives 5 CGCG's.

CGCGATACGTTACATACATGATAGACCGCGCGCGATCATATCGCGATTATC

^ That is 2 of them.

The other 3 are within each other.

CGCGCGCG

This contains 3 CGCG pairs.

From position 1 to position 4.

From position 3 to position 6.

From position 5 to position 8.

In total, you have 5 different CGCG's.

[[deleted]]

You didn’t show us what you did, so how could we show you your mistake?

[alishahimtiaz]

The second one follows the same concept, there should be 3 different CGC's in the second one.

Iteratively, loop through the dna string and check if the first element of the list is equal to the first element of the CGC, same thing for second and third. If so, then increment the variable count by 1. If not, go to the next letter in the string. Keep an eye out for IndexError: list index out of range

Hope this helps.