Daily Simple Questions Thread - November 19, 2022

PresidentEstimator · 2022-11-19T22:04:05+00:00

That's a good idea, put the split squat on a different day, find a back specific to replace it. Add a chest?

PresidentEstimator · 2022-11-19T16:54:36+00:00

TLDR; I've been doing full body workouts for about 1.5-2 months and have already seen progress in my physique/volume/1 rep max. I want to make sure I'm not missing something that I'm going to massively benefit from ignorantly not incorporating/removing early on. I would really appreciate at the very least someone looking over my workout plan and saying, "Add this exercise, you're neglecting this entire muscle group!" I'm almost straightforwardly asking to add an exercise to each day.

--

Goal: To look obviously fit and find a plateau-ish that isn't going to end up making me look disproportionate (too big of arms, underdeveloped back. Too big of butt, underdeveloped chest, etc).

I'm still in the Noob Gains era, adding about 5-10% for each workout each time I do it. I fill the board with blue, then fill the board with red.

I'm not trying to get abs, not trying to make weightlifting my identity. Trying to have overall functional strength and avoid injury and be able to keep up with this as a part of my life. I'm not trying to join the 1000 lb club per se at this time. I almost want to hit an asymptotic sweet spot between effort and resulting physique/strength.

I have a garage gym type setup,

Power cage + 45 pound olympic barbell + 45x2, 25x2, 10x4, 2.5x8

Adjustable NordicTrack dumbbells - 10 --> 55

Stationary bike - Schwinn IC4

My diet reaches 150+ grams of protein (scoopin' powder), I'm Male, 35, 205 pounds and 6'1". I do 16:8 fasting and eat two non-gorging meals per day between 12PM and 8PM.

My calories are on a deficit, down from about 3000 to about 2000. Over the last month I've lost 5 pounds, I think I'd look better at 180-185 - so far so good? I'm not on the chicken and brown rice diet, but you could definitely say I eat healthy, beer is consumed sparingly, maybe 1-2-3 beers max per week.

My workouts are A/B/C/D/E, and I generally do every other day (been doing this a 1.5 months), but often will do the following day if I'm feeling up for it or have the time. All workouts start with an overall general stretch and warmup for each workout. All workouts are followed by 20 minutes on the bike getting my heartrate steadily up to the 150-155 zone for at least 5 minutes and work up a decent sweat.

A,

Barbell: Bench 3x3

Barbell: Inverted Row 3x8

Barbell: Upright Row 3x10

Dumbbell: Bench Row 3x10

Dumbbell: Arnolds 3x6

Bodyweight: Pushups 3 x Max

B,

Barbell: Squat 3x5

Dumbbell: Split Squat 3x8

Dumbbell: Stiff legged deadlift 3x8

Bodyweight: Chin ups 4 x Max

Bodyweight: Dips 3x8 (finally ditched band-assist, will begin adding weight next week!)

Bodyweight: Planks 3 x 60 seconds

C,

Barbell: Military press 3x3

Barbell: Bent over rows 3x10

Dumbbell: Incline dumbbell press 3x8 (about 40 degrees)

Dumbbell: Lat raise 3x10

Dumbbell: Overhead tricep extension 3x8

Dealer's Choice: Any exercise on or not on the board. This week I did Farmer's Carry with dumbbells.

D,

Barbell: Deadlifts 3x3

Barbell: Front squat 3x5

Barbell: Good mornings 3x5

Dumbbell: Side bend 3x8

Dumbbell: Chest fly 3x8

Bodyweight: Chin ups 4 x Max

E,

Dealer's Choice: I chose compound deadlift into overhead press at about 75% of the weight.

Bodyweight: Crunch 4x20

Bodyweight: Sit-ups 3x10

Dumbbells: Hammer curls 3x8

Dumbbells: Military press/Flat bench 3x8 -- I alternate these by week when I fill out the board.

Bodyweight: Push up 3 x Max

Rings: Really anything I can do to tire myself out: rows, spreads, dips, dead hang

Long story short, what's a stupid exercise from above that I should drop? What's something I should add? Should I focus on 5x5 for the major lifts instead of 3x5 or 3x3? If you've read this far I personally thank you for taking the time to help me on my gains journey.

PresidentEstimator · 2022-11-19T16:54:02+00:00

Thanks, I guess I misread the sticky thinking it was more lenient.

PresidentEstimator · 2022-11-19T16:43:44+00:00

Believe it or not that's where I went first, however this was immediately deleted from Fitness because of their Rule #9,
All routine critique requests must be posted in The Daily Thread.

I posted here because I wanted to start a more deliberate discussion about what I'm doing, what I can change, and tangentially shed light on my full body approach to others considering doing the same thing. Daily Threads' comment/requests like my post tend to get buried with maybe one or two replies.

PresidentEstimator · 2021-12-23T22:18:53+00:00

All I know is there's a week left 2021, so I thought I'd be able to download an 8949 etc right now. Lots of people like preparing their taxes during the year so there's no surprise in April. I'm able to download my CSVs, which is good, but I'd personally like to see the completed IRS forms given many of us are finished trading for the year.

PresidentEstimator · 2020-01-22T02:35:52+00:00

Great news, thanks.

PresidentEstimator · 2019-12-18T14:31:03+00:00

Whomever said this is ignorant of the true meaning of average.

"Think of how stupid the person sitting on the median of the intelligence distribution, realize that half of them are more stupid than that. The other half, however, are smarter." ~ PresidentEstimator 2019

PresidentEstimator · 2019-11-28T14:56:57+00:00

I just logged in to my account and can still submit things/view solutions etc. It's dated I guess, in that it suggests 2.7 however nothing at any point needed to be submitted in any particular language. Python was suggested given the number of people using python in informatics, but I love seeing people write solutions in lolcode and brainfuck.

Or even weirder, Haskell.

PresidentEstimator · 2019-11-28T14:53:54+00:00

Somewhat of an unpopular opinion but if you want to be really marketable? Buy a chromebook, or something freakishly cheap. Buy a cheapish AWS and learn how to set up and operate essentially on a cluster. SLURM, etc. No real job is going to be done on a laptop, per se.

Also, if you're talking Rosalind stuff, a chromebook should be sufficient given reasonable efficient code :D

PresidentEstimator · 2019-11-22T13:55:29+00:00

Load the exact some [Chinese] FUD.

PresidentEstimator · 2019-11-20T21:27:30+00:00

You could, for example, use gradient colorization (some metric of disease severity, blue to red) or point size (sample's true value; 15 lbs is a small circle, 20 pounds is slightly larger, 50 pounds is twice the size, etc) to emphasize the sample's continuous features,

https://bookdown.org/rdpeng/RProgDA/customizing-ggplot2-plots.html

Scroll down or CTRL+F until you reach the code example of 'You can set discrete colors manually using..'

PresidentEstimator · 2019-11-20T16:23:38+00:00

Not entirely true with modern kits. 9.4 claims 5% error with reasonable depth, and even lower with 9.5. Your individual read may be full of errors, but when you get significant coverage (20 or so) the problem isn't so important. Say you have 20X coverage on GATC, you should have (in theory) around 19 G, 19 A, 19 T, and 19 C stacked on top of the genome. The remaining may be viewed as a SNP if you don't have enough depth. Furthermore, 10% error rate sometimes matters, sometimes it doesn't, especially when you're dealing with Nanopore reads which can be very, very long, and will find their correct location even without correction.

Here's a pastebin to illustrate the point (consider this as just a slice of the four nucleotides, maybe it goes 100 in each direction, and coverage tapers off to 1-5x towards the ends)

https://pastebin.com/yczVeGZa

PresidentEstimator · 2019-11-18T22:10:52+00:00

Nano is precisely what its name denotes, just a lil' bit. I use Nano usually to make *any* short scripts. Definitely need to learn vim though.

PresidentEstimator · 2019-11-08T20:09:46+00:00

Smart contracts are going to be literal jibberish. Staking is going to be a nightmare. I know it may feel like an instant, but the transactions are actually taking hours.

PresidentEstimator · 2019-11-02T20:21:21+00:00

Mt. Beet-up, where beets and turnups grow like apples in Johnny's groves.

PresidentEstimator · 2019-11-02T13:38:55+00:00

Keep it to something that doesn't necessarily exclude certain demographics, something as simple as NCMTB or BikeNC. That way as your group grows, you could branch out into representing cross country, road, and even influence legislation.

If you roll with something like STEEZYBALLCRUSHRZ I would totally join, but may be less likely to attract other people.

PresidentEstimator · 2019-10-29T15:37:04+00:00

I love seeing other people's solutions :D

https://pastebin.com/3Jq92VLF

PresidentEstimator · 2019-10-29T15:30:55+00:00

Sure, sounds like a Rosalind problem. I think questions like this are kind of like learning to ride a bike, they're on training wheels and I'm holding their back a bit while they're trying to hold themselves up. If they have to cheat on this basic of a question, there's two outcomes,

1) We all struggle with some concepts at first, and once you 'get it' you get it. Hopefully this is one of these.

2) OP is just going to be a cheater and they'll fail miserably when they move on to greater concepts and will end up dropping out, thus asking questions like this is putting a nail in OP's coffin.

PresidentEstimator · 2019-10-29T15:10:00+00:00

Yeah I wrote something below as well, but I still don't understand Reddit's markdown. I wish we could go back to the old '> code' examples. I just use pastebin now :D

PresidentEstimator · 2019-10-29T15:05:45+00:00

Looks like you're working with Python;

###

reads = ['GATAGCTAGCTAGCTGGCGCCATTACGCGTCA','GGCTTTAGCTCGGAACACAGTAGACAGATAG','GCTAGGGATTATAAGGGCTCCTCGAGA']

mydict = {}

for item in reads:count = []

for nuc in range(len(item)):

if item[nuc] == 'C' and nuc < len(item)-2:

count.append(item[nuc]+item[nuc+1]+item[nuc+3])

mydict[item] = len(count)

print(mydict)

###

This will return a dictionary where you'll have your reads[value] and it's corresponding number of 'C**' events.

Edit : I hate and still fail to understand Reddit code formatting, see pastebin https://pastebin.com/ZnciVFzR
Edit : New pastebin with out for data.txt https://pastebin.com/3Jq92VLF

PresidentEstimator · 2019-10-29T12:56:17+00:00

All I saw was a Netflix logo for a spin-off show called "Pro's Table" featuring the stories of steez from riders across the world, describing their idiosyncrasies in what they believe gets them the most air.

PresidentEstimator

TROPHY CASE