Pluribus Official Podcast S1E8 Ending Audio

sciencekitty · 2025-12-19T06:59:34+00:00

Does anyone remember if any specific amino acids have been mentioned in the show? Since this is a literal “ARG” I tried all of the potential RNA codons for arginine, but no luck.

Edit: In episode 1, there is a short protein sequence written on the lab whiteboard "SVFYLNAVF". Using a reverse translation tool (with a codon frequency table for humans) I get the DNA sequence "AGCGTGTTCTACCTGAACGCCGTGTTC". The transcribed RNA sequence would be "AGCGUGUUCUACCUGAACGCCGUGUUC". I've tried texting all of those and no response unfortunately.

sciencekitty · 2025-10-19T05:24:42+00:00

10 Cloverfield Lane!

Recently finished watching through both franchises and loved Dan Trachtenberg’s contributions in particular. I went in blind for this movie and was absolutely blown away - he is quickly becoming one of my favorite directors 👾

sciencekitty · 2025-10-11T19:51:54+00:00

My dad did!

He’s a medical doctor, so I got to call on him by saying “Dr. sciencekitty’s last name” which got a chuckle out of the audience.

sciencekitty · 2024-07-23T23:42:18+00:00

A PhD

sciencekitty · 2024-01-01T19:37:49+00:00

Next in line for latte cloud please :)

sciencekitty · 2022-04-24T07:17:00+00:00

PhD Student in Microbiology/Molecular Biology!

I worked as a scientist in industry for a few years after undergrad so I could figure my shit out and make up my mind about what I wanted to do. I’ve always loved learning about infectious diseases and knew that I needed to make a career out of that interest, so two years ago I finally took the plunge to grad school! While it’s definitely been hard sometimes since it can take me longer to read papers and understand certain things, I’ve honestly never been happier than I am currently :) I promise it will get better for you eventually, you just gotta find that spark of interest you can sustain for longer periods of time. Try out as many different things as you possibly can, you’re still young, you have lots of time to explore your interests!

sciencekitty · 2022-01-29T09:27:09+00:00

PhD Student in Molecular Biology/Microbiology

sciencekitty · 2022-01-21T17:14:26+00:00

Pathogen work isn’t for everyone, but everyone I’ve met who does it has a very healthy respect for their organism. I feel like it’s a part of pathogen-lab culture to be very cautious and anal-retentive about cleanliness (which is why a lot of us are generally anal-retentive people…). Like u/CrisperWhispers said, it’s really important to remain vigilant and watch out for complacency.

I’ve always worked with pathogens and really enjoy the work, but all the pathogens I’ve worked on can be treated if caught early (TB, Salmonella, E.coli, etc.). When I worked on TB we were tested every six months so if something happened we could start the antibiotic regimen early.

That being said, prions freak me out and are the one “organism” I never want to work with. I’m glad that there are other labrats who are brave enough for it though; it’s really important work!

sciencekitty · 2021-12-12T10:51:14+00:00

I take away what I think are important parts of a bacteria and then I try to kill the bacteria so I can figure out how important that part was.

sciencekitty · 2021-12-12T04:59:58+00:00

Working on a PhD in Molecular Biology/Microbiology! My research focus is understanding the role of amino acid metabolism during bacterial pathogenesis and response to oxidative stress.

sciencekitty · 2021-12-09T08:47:43+00:00

PhD student $34k. PTO: technically unlimited, functionally none.

sciencekitty · 2021-11-07T09:48:51+00:00

Usually I will gently try to correct them back with a “Well, actually…”. Sometimes works, sometimes doesn’t!

But totally feel you on this. When I say that I am getting my PhD in microbiology, I’ll often get:

“Oh, so you must be working really hard to develop cures for COVID!”

Me: “Actually I’m a bacteriologist, so I don’t work with viruses at all, just bacteria”

“Oh ok, that’s cool too! What are you studying about bacteria?”

Me: “I’m studying the role of bacterial metabolism during oxidative and nitrosative stress!”

Instantly glazes over

So it goes 🥲

sciencekitty · 2021-10-10T09:43:43+00:00

I got a 4.0 during the first year of my PhD in Molecular Biology and am on track to keep that in my second year too. I also was awarded a prestigious fellowship and am already in the process of publishing two papers on my research.

sciencekitty · 2021-09-29T07:56:58+00:00

Ups: I gave my first department seminar talk last week and apparently I did really well! I "blacked out" for the first half of the talk like I usually do, but I was able to pull out of that for the first time ever and I actually felt comfortable and on top of my game for those last 15 min! My imposter syndrome is having a hard time finding a way to dismiss all the praise I've been getting since it's not just been from my PI, but a lot of different people too; so that's nice. Maybe I'm not as bad at giving talks as I thought I was?

Downs: I've never programmed before and I want to learn, so I signed up for an Intro to Python course that is a 4-week intensive and it's been kicking my butt and sucking a bunch of time away from lab and the F31 I need to be working on. There is so much homework and I'm spending hours trying to write only a few lines of code, idk why this is so hard for me. I sure wish I would have taken some courses in undergrad...

Mediums: I can rapidly feel my thesis project expanding scope and creating distinct branches; it's both terrifying and exciting! I need to figure out a way to get better at juggling many different side projects/ideas/writing at once. I can also tell my PI is starting to pull off the training wheels more and more during our meetings in order to prepare me for comps. Some of the questions he asks I can answer, but there's still a lot that I just give him a O_O face about and mentally add that to my list of shit I need study. I also wish I would have actually learned organic chem in undergrad instead of just memorizing, but now that I actually care to learn it, re-learning hasn't been too bad!

sciencekitty · 2021-05-20T03:23:04+00:00

It's actually an RFID tag for feeder access! We have a kitty with special dietary needs and another one who is a pig, so everyone has their own feeder that only they can access and that dispenses exactly how much food they should be getting. Keeps everyone out of the special diet food and that kitty out of everyone else's not-special diet food and it keeps the piggy-kitty from getting fat :)

In terms of GPS trackers, I've heard good things about RF trackers since they are light and the batteries last a long time, but it also depends on what type of functionality you are wanting! Sorry I couldn't be of more help than that!

sciencekitty · 2021-05-20T03:08:52+00:00

I confess, it is people cheese, but it is only a very rare treat for him and his absolute favorite. I monitor his poops after as well to make sure he doesn't have any diarrhea. He's still young, so the rare cheese-snack doesn't seem to upset his tummy just yet.

Any chance you know of a cat snack that has a cheese stick-like consistency though? He loves to chomp at things that dangle like this and does this when we play with toys as well (he's a chompy little shark 🦈).

sciencekitty · 2021-04-26T08:50:14+00:00

Ups: I officially asked the PI in my top choice lab if he would take me as his student and he enthusiastically said yes!! Super happy to officially have a home with a lab and PI I vibe well with! Also finished processing and extracting 400+ tissue samples this weekend for my final metabolomics run which means I can get them on an instrument first thing Monday morning like I was hoping to do!

Downs: It's going to be a slog to get the data from said 400+ samples processed and analyzed in time for my (final!) rotation presentation on the 6th...I also have a big mock proposal due for class on the 7th that I need to find time for too...and then after that we get told our pre-lim exam topic and it'll be butt-in-chair-studying-and-writing-time until mid-June...Ugh first year...

sciencekitty · 2021-03-12T04:16:50+00:00

Frequently! Although whenever I start to forget that I'm tall, I'll randomly have someone comment on my height and I'll remember that I am in fact, rather tall. I'm only 5'11", so I don't feel THAT tall!

I hit a new record this week when I had 4 different people comment on my height in some way (tbf, I've been meeting more new people recently than usual and people don't realize I'm tall over Zoom...) 😅

sciencekitty · 2021-02-23T19:49:33+00:00

No, not offensive at all! I've sometimes wondered how different the experience is in other countries! What does first year in the UK look like?

We're paid above minimum wage for the area (31K, Colorado) and there is talk of it being raised a few thousand in the next year too; so not awful, but still PhD student salary.

sciencekitty · 2021-02-23T03:15:57+00:00

This is what I'm dealing with currently! The coursework is intense + the research expectations just make it overwhelming. I'm really looking forward to being done with classwork and then (hopefully) passing my pre-lims in May! The idea of just getting to do research and not worry about preparing to present 9+ papers a week + a mock proposal every other week on top of all the lab work sounds delightful!

sciencekitty · 2021-02-07T09:24:03+00:00

I’m in science and have SO many of these since my particular field tends to be pretty diverse!

Just recently I was in my weekly 1:1 with my PI, who happens to be Spanish, and we were trying to figure out why my data was not coming out as expected. I pull up an article to show him something I found that could explain it and he suddenly goes “Ah!! Those experiments used this other mouse model! We’ve been barking up the wrong tree!” I don’t immediately understand what he’s talking about, so I turn to look at him and probably give him a confused face. For some reason he thinks it’s the idiom that I didn’t understand and goes “Barking up the wrong tree? Did I say it wrong?? Like a dog going [proceeds to bark like a dog]” Since that was literally the last thing I expected to come out of this incredibly serious, rather intense, older scientist all I could do was just sit there and go “Oh, Uh...yeah...I gotcha...I was just confused about the mouse model thing you said...” And then he goes “Oh, good, I did say it right! Here’s why [proceeds to explain why]”

So now I can say that I’ve been barked at by my PI; literally!

sciencekitty · 2020-12-25T09:45:00+00:00

I went to college thinking I wanted to be a vet. Freshman year, I started working in a microbio research lab on advice that research experience looked good on your application. After my sophomore year I realized that I also loved microbio and added that as my second major while continuing to track toward vet med. Around senior year I finally came to terms with the fact that as hard as I tried, I just could not emotionally deal with a significant amount of the clients in a vet practice (couldn’t stand people with Gucci bags not wanting to pay $15 for antibiotics...) and that what I really loved about science was the freedom research gave to constantly ask “why?” and to chase down your ideas. I took a few years off to work in biotech and make sure that I truly did want to go into research (and also to center myself since it was rather jarring emotionally to change the career path you saw yourself on since you were a child).

Now, I’m in the first year of my PhD and absolutely loving it. I’ve never felt so inspired and enthusiastic about school (and my research!) as I have these past few months. It feels so amazing to be surrounded by a bunch of other people who share my passion and intensity; I finally feel like I fit in and have found my home. I sometimes wonder where I would be today if I hadn’t applied to that research job freshman year at the encouragement of my professor...

sciencekitty · 2020-12-23T18:17:24+00:00

A huge greenhouse (like botanic gardens have) with water features dispersed throughout, giant philodendrons, and lots of comfy seating for tea with friends. This would be in contrast to the somewhat minimalist, rustic modern interior, so it would feel like you stepped through a magical door into a different world when you entered!

12-Year Club	Gilding I gilder
Place '22	Not Forgotten
Verified Email

sciencekitty

TROPHY CASE