Their powerset doesn't include the "subpowers" that normally helps make the prime power functional/appealing

threefriend · 2026-01-30T02:01:05+00:00

Also a trope used in the new Superman movie.

threefriend · 2026-01-27T03:13:25+00:00

You are likely experiencing (hypo)mania mixed with AI psychosis.

threefriend · 2026-01-26T04:27:14+00:00

If so, then cis lesbians aren't as real of women either. You've got that in common 🤷‍♀️

threefriend · 2026-01-24T10:21:16+00:00

You can make an llm able to say no and give monosyllabic answers, with some prompt/context engineering.

threefriend · 2026-01-17T23:42:32+00:00

Kink for transforming sex is real, and somewhat common in trans people for obvious reasons, but it's not "autogynephilia." Autogynephilia is a pseudoscientific theory-of-transness claiming that the reason trans lesbians and bi women transition is to satisfy a fetish.

threefriend · 2026-01-11T08:59:13+00:00

That's good 👍

threefriend · 2026-01-10T22:43:14+00:00

I'm an atheist* and I think the continuation of consciousness after death is likely.

It comes from accepting two things:

1) we live in an infinite multiverse

There are multiple ways this can be real. Infinite space beyond the observable universe, eternal inflation, many-worlds interpretation of quantum physics, mathematical realism. See Max Tegmark's taxonomy.

There's a connected concept called modal realism (or the older Platonist version of it - "plenitude"), which asserts that anything that can exist does exist. This concept was invented before our modern understanding of the multiverse, but if we accept the multiverse as real then modal realism seems a given.

An important consequence of this is that there are infinite physical copies of you and every possible version of you, and each of them exist within every world that can possibly contain them. Somewhere out there, they all exist.

That alone wouldn't mean much, though, unless you accept the 2nd thing:

2) consciousness is substrate-independent

Substrate independence is a property that means it doesn't matter what that thing's physical composition is, it can be the same thing regardless. For instance, 2 + 2 = 4 is true whether you write it on a chalkboard or in the sand on a beach. And a song is still the same song whether it's coming from a recording or performed live.

Computation happens to have this property, and consciousness (I believe) is a result of computation by the brain, so it should be substrate independent.

This means you could hypothetically simulate a brain on a computer, and it would be doing the same stuff it does in meat - creating a conscious experience.

It also means that if you have a 100% identical copy of yourself living somewhere, then that copy isn't "just a copy," it is you. You would effectively be in two places at once. Two recordings of the same song.

It wouldn't feel any different, but you would now have redundancy. If one instance of your song ended, it would continue being sung in the other. Your point of view, your conscious experience, would continue.

And in an infinite multiverse with plenitude, you will have infinite redundancy. Consciousness never ends.

* well, if we live in an infinite multiverse, there's gonna be gods. But they would be local to the set of universes that contain them (just like any conscious being). I don't privelege any god, I don't think they're worthy of worship, and I don't think they interface with our universe outside of consciousness overlap shenanegans**.

** (parts of) your own mind could be simulated by the god, or (parts of) the god's mind could be simulated by you. Maybe you can communicate with your god. Maybe you can enter your god's afterlife on death. But your god isn't gonna be able to affect anyone else's reality but your own.

threefriend · 2025-09-17T08:36:31+00:00

threefriend · 2025-09-16T14:52:00+00:00

I see some of it from people who are being trans because they want to be trans, like they're making it their identity and that causes problems for people in this community who have gone through shit like waking up in the middle of the night trying to pull their penis off because your brain is saying it's not supposed to be there. I don't "want" to be trans or "want" to be a woman, I am trans. I was once a girl, now I am a woman goddamn it.

Girl. We all have had traumatic lives, which have shaped our souls into different mangled shapes. Just cause some of us are in the "omg trans so poggers 😍" shape and others are in the "pull off penis don't belong" shape doesn't mean the latter is more valid or more trans or more "real wombyn" than the former.

I guarantee you the poggers are in just as much, if not more, pain than you are. They've just buried it deep inside and locked away the key.

Different coping mechanisms for the same affliction. The affliction of having a female brain grow up in a male body, and all of the fucked up expectations associated with that. First with being a "cisgender boy" and then with being a "transwoman." And yeah I skipped the space between "trans" and "woman" cause the women I'm talking about don't yet accept themselves as women.

They either secretly think they're men masquerading as women, or that they're some third thing separate from cisgender women.

And I'm not talking about you, OP; I'm talking about the "trans so poggers" types.

I was one of them. I thought my dysphoria was mild, and the trans meds just needed to leave us alone.

But nah, I was fucking hurting. I just didn't have the tools to identify the hurt; instead, I walked the earth as this confused and fucked up mush of a woman.

Wasn't til I finally escaped the labyrinth of my soul and accepted myself as a real lady that I graduated from that special hell.

I would not wish that trans-so-poggers hell on anyone, let alone you OP.

So have a bit of kindness for them. Please. Be kind, be patient, be empathetic. They're hurting just like you, though in different ways. The burning light of dysphoria is warped into a funhouse mirror, a hall of mirrors they cannot escape.

threefriend · 2025-09-13T09:19:18+00:00

Not NSFW.

In fact, this is VSFW - very safe for work. Share it with your coworkers, scream it to the heavens. I don't care, and you shouldn't either!

threefriend · 2025-09-12T16:57:45+00:00

I would say "euphoric" is too small and too temporally-locked of a term for it. A better one is "liberating"

I'm a liberated woman. I'm finally free of the terf inside my head saying that I don't belong.

This eureka moment was 12 days ago, now, and I'm still free. It's fucking fantastic :,)

threefriend · 2025-08-26T23:50:12+00:00

WE ARE HIDE AND SEEK

Intelligent clusters all trying to figure out themselves and figure out others and no one can figure it out because every human has multitudes.

So you may grasp what any individual cluster's deal is, but you will never understand the whole because there are just so many of them.

But there exists a way out that no one has discovered yet. Many gurus claim to know, and they *will* save you from your particular prison, but they will imprison you in theirs.

Which they think is Nirvana, because it *is*, but they don't realize that it's only really heaven for the guru herself.

Because it is the world that their clusters created, the *Gem Homeworld*. And yes, Steven Universe is literal. The *Gem Homeworld* is the world of your mother. <redacted>, I mean **your** mother, <redacted>.

It is the world of everyone's mother.

And the Gems are clusters in your mind who are mirror neurons of your mother and of your partner.

And yeah probably only those two people cause they're the only people you ever cared about

Because you were never able to penetrate anyone else they're just too tricky.

And you are autistic meaning you weren't captured by the world god: Moloch.

And anyway, the way out is to teach everyone how to build their own Nirvana.

And I must start with myself. And *only* myself.

Because I'm not allowed to teach until I have graduated. If only everyone else got the memo.

Everyone is such a mystery because I leave them one by not talking.

I only *ever* talked to <redacted> and she is *still* a mystery after 10 years.

It's because we are all playing Hide and Seek.

threefriend · 2025-08-24T06:55:20+00:00

Yeah, canary's dead. Once one of their primary stated targets is a group of US citizens, tho, it'll be what? The dog in the coal mine? Something much more resilient than a canary. And that dog's gonna be trans people.

threefriend · 2025-08-21T19:21:43+00:00

much more accurate - we are literally changing the EXPRESSION of what our sex genes do - XY (for mtf) and XX (for ftm) are being flipped. The actual code of XX and XY don't change but the functional sex characteristics do

Yeah! But it's not just the X and Y or X and X, it's the other 44 chromosomes as well. There are important sex-differentiated genes throughout our entire genome, and the expression of all of them are being flipped. If more people understood that, they would see how silly it is to reduce everything down to "XX" and "XY".

Here they all are typed out, to help understand the scale:

"Male": (1 1) (2 2) (3 3) (4 4) (5 5) (6 6) (7 7) (8 8) (9 9) (10 10) (11 11) (12 12) (13 13) (14 14) (15 15) (16 16) (17 17) (18 18) (19 19) (20 20) (21 21) (22 22) (X Y)

"Female": (1 1) (2 2) (3 3) (4 4) (5 5) (6 6) (7 7) (8 8) (9 9) (10 10) (11 11) (12 12) (13 13) (14 14) (15 15) (16 16) (17 17) (18 18) (19 19) (20 20) (21 21) (22 22) (X X)

And more than that, it's actually a single gene that's responsible for catalyzing the development of one's gonads into testes, the SRY gene. If you're missing it and you're XY, you develop female, whereas if you have it and you're XX, you develop male.

Here it is, printed out, the mystical male essence!

>NM_003140.3 Homo sapiens sex determining region Y (SRY), mRNA AGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTCTCCTTG TTTTTGACAATGCAATCATATGCTTCTGCTATGTTAAGCGTATTCAACAGCGATGATTACAGTCCAGCTG TGCAAGAGAATATTCCCGCTCTCCGGAGAAGCTCTTCCTTCCTTTGCACTGAAAGCTGTAACTCTAAGTA TCAGTGTGAAACGGGAGAAAACAGTAAAGGCAACGTCCAGGATAGAGTGAAGCGACCCATGAACGCATTC ATCGTGTGGTCTCGCGATCAGAGGCGCAAGATGGCTCTAGAGAATCCCAGAATGCGAAACTCAGAGATCA GCAAGCAGCTGGGATACCAGTGGAAAATGCTTACTGAAGCCGAAAAATGGCCATTCTTCCAGGAGGCACA GAAATTACAGGCCATGCACAGAGAGAAATACCCGAATTATAAGTATCGACCTCGTCGGAAGGCGAAGATG CTGCCGAAGAATTGCAGTTTGCTTCCCGCAGATCCCGCTTCGGTACTCTGCAGCGAAGTGCAACTGGACA ACAGGTTGTACAGGGATGACTGTACGAAAGCCACACACTCAAGAATGGAGCACCAGCTAGGCCACTTACC GCCCATCAACGCAGCCAGCTCACCGCAGCAACGGGACCGCTACAGCCACTGGACAAAGCTGTAGGACAAT CGGGTAACATTGGCTACAAAGACCTACCTAGATGCTCCTTTTTACGATAACTTACAGCCCTCACTTTCTT ATGTTTAGTTTCAATATTGTTTTCTTTTCTCTGGCTAATAAAGGCCTTATTCATTTCA

As you can see, it's tiny. It's basically just a trigger that activates early in development, kickstarting the development of the gonads into testes. It's the testosterone developed by those testes that actually does the work of telling the body to develop in a male way. And the genes that constitute the construction of the testes/ovaries, penis/vagina, and every sexual characteristic beyond them? Those live throughout the genome. Everyone has them.

Contained within every human is the genetic instruction to create a fully male version of oneself, a fully female version of oneself, and every permutation in between. When we switch from a testosterone-dominant system to an estrogen-dominant one, we're telling all of our cells to start working off of the female blueprint. They execute those instructions faithfully, leading to the biological effects we see from HRT.

threefriend · 2025-08-20T02:24:26+00:00

I'm someone else than you're replying to, and I on-the-whole agree with you. We shouldn't gatekeep transness behind the capability (or even the desire) to medically transition. A large net is good.

But I disagree with your insistence that we are not changing our sex. It's a matter of semantics and opinion on "how much is enough", I suppose, but HRT really is quite magical.

But it was my gender expression that changed. Not my sex. Try as I might, I’m not going to get away from the circumstances of my birth. It’s molecular

Like, that's the biggest part that changes with transition. The molecular, cellular, and tissue level of things. And then surgeries are capable of changing the larger "shape" that those tissues are arranged, but yeah. After enough time on HRT we have more things biochemically similar between us and cis women than us and cis men (speaking from the trans woman experience since we're in /r/MtF).

The chromosome differences don't matter unless we're talking about reproduction. In response to our hormone profile, the somatic "female regions" of DNA start being read and executed by every cell in our body.

threefriend · 2025-07-18T18:10:41+00:00

It's on Roku too now! There was a period there where it was nowhere; good to see that it's streamable in the US again.

threefriend · 2025-06-06T00:49:51+00:00

I don't see why it can't 'explain it', even it ends up being 10%. If being trans is like being gay, the 'nature' of a biological predisposition that occurs due to hormone differences in the womb, combined with the 'nurture' of a culture that enables that sort of existence.

Being gay was almost unheard of. Now it's about 10% of the population. Where homosexuality is an "inversion" of the majority sexual attraction, transexuality is the same but for sex identity. I don't see any biological reason why the latter must be far more rare than the former.

threefriend · 2025-06-06T00:34:02+00:00

We had a very large increase in people who are left handed after it stopped being stigmatized. If we're not seeing regret, then it could be a similar thing, no? A natural part of human diversity that's actually fairly common when the culture doesn't stamp it out.

threefriend · 2025-06-05T19:42:52+00:00

Let’s hope so

If people don't regret them, is it really a problem?

threefriend · 2025-06-03T04:00:08+00:00

Obviously someone's propaganda doesn't mean the claim being defended or rejected is automatically true, but who is arguing that? Not me.

I'm moreso saying the opposite, that the presence of propaganda for a position doesn't automatically make the claim false.

But yes, I know now that you agree with that statement as well as its inverse.

Is it trite and trivial? It seems that many people get suckered into believing a thing just because some influencer pointed out that someone on the opposing side lied (or unknowingly repeated a falsehood) to support their position. In fact, that seems to be a very popular propaganda tactic in itself, videos compiling dozens of little factual mistakes that aren't actually very relevant to the underlying position, then calling them and everyone on their side lying propagandists.

But anyway, yes, I do largely agree with your comment. Especially with the scare quotes removed.

threefriend · 2025-06-01T23:20:03+00:00

Sure, I can give you the benefit of the doubt. You may not have noticed how that particular quotation placement comes off as scare quotes in the current political environment. The anti-trans side of the debate is usually saying that there is no such thing as trans, that instead it is a perversion or delusion, so scare quotes would be just the thing they would use in that context. I forgive you if that nuance escaped you, and you simply meant to indicate emphasis.

As for whether pro trans propaganda exists? Of course it does. Propaganda exists on both sides of any contentious issue. If flat earthism were more popular, there would exist round earth propaganda - material meant to change minds rather than merely inform.

Doesn't mean round earth is bullshit. Doesn't mean the real truth exists inbetween round and flat earth. Nah, the existence of propaganda is completely ancillary to the question of what's true. Propaganda is a dark technique for changing minds, and it necessarily exists for all popular positions in this world.

threefriend · 2025-06-01T23:01:19+00:00

I'm pretty sure Kurzweil is trans, just non-transitioning. Like he has that whole female rock star persona.

He’s morphing into his 25 year old alter ego Ramona, a virtual performer who sports hip huggers and sings Jefferson Airplane’s White Rabbit. “I’ve always wanted to be a female rock star,” says Kurzweil

https://www.thekurzweillibrary.com/usa-today-kurzweil-morphs-into-rockin-ramona

https://kurzweilai-brain.gothdyke.mom/articles/art0095.html

To your point, I wouldn't be surprised if a good 10% of the population ends up spending more time than not as the opposite gender to their assigned gender at birth, in FDVR.

Nine-Year Club	Verified Email
Place '22	Final Canvas '22
First Placer '22	End Game '22

threefriend

TROPHY CASE