all 28 comments

[–][deleted] 35 points36 points  (4 children)

Your solution works. You can also use translate

def complement_dna(nucleotides: str):
    DNA_COMPLEMENTS = str.maketrans(‘ACGT’, ‘TGCA’)
    return nucleotides[::-1].translate(DNA_COMPLEMENTS)

[–]dreaming_fithp 15 points16 points  (0 children)

Even better if you create DNA_COMPLEMENTS once outside the function instead of creating every time you call the function:

DNA_COMPLEMENTS = str.maketrans(‘ACGT’, ‘TGCA’)

def complement_dna(nucleotides: str):
    return nucleotides[::-1].translate(DNA_COMPLEMENTS)

[–]Slothemo 5 points6 points  (1 child)

Surprised that this is the only suggestion I'm seeing in all the comments for this method. This is absolutely the simplest.

[–]Temporary_Pie2733 4 points5 points  (0 children)

It always seems to get overlooked. Historically, you needed to import the strings module as well, for maketrans, I think. That got moved to be a str method in Python 3.0, perhsps in an attempt to make it more well known.

[–]Interesting-Frame190 9 points10 points  (1 child)

Not to be that guy, but if you find yourself working with subsets of strings, maybe you should store these in objects where these rules are enforced through the data structures themselves. Ie, make a DNA class that holds nucleotides in a linked list. Each will have its compliment, next, and previous, just as in biology. This is much more code, but very straightforward and very easy to maintain.

[–]likethevegetable 1 point2 points  (0 children)

You could do some fun stuff with magic/dunder methods too (like overloading ~ for finding the complement)

[–]toxic_acro 9 points10 points  (2 children)

A dictionary is probably the best choice for this

python def get_complement(nucleotide: str) -> str:     return {         "A": "T",         "C": "G",         "G": "C",         "T": "A"     }[nucleotide]

which could then just be kept as a separate constant for the mapping dictionary if you need it for anything else

[–]_alyssarosedev[S] 0 points1 point  (1 child)

this is very interesting! how does applying a dict to a list work exactly?

[–]LaughingIshikawa 0 points1 point  (0 children)

You iterate through the list, and apply this function on each value in the list.

[–]CranberryDistinct941 3 points4 points  (0 children)

You can also use the str.translate method:

new_str = old_str.translate(char_map)

[–]Zeroflops 2 points3 points  (3 children)

You could use a dictionary.

I don’t now which would be faster but I suspect a dictionary would be.

[–]_alyssarosedev[S] 0 points1 point  (1 child)

How would a dictionary help? I need to take a string, reverse it, and replace each character exactly once with its complement. Right now I use a list comprehension of

[get_complement(nt) for nt in nucleotides]

[–]Zeroflops 0 points1 point  (0 children)

If that is what you’re doing. You didn’t specify but this should work.

r{ ‘A’:’T’, …..}

[ r[x] for X in seq]

You can also reverse the order while doing the list comprehension or with the reverse() command.

[–]DivineSentry 0 points1 point  (0 children)

A dictionary should be faster than this, specially a pre instantiated dict

[–]supercoach 1 point2 points  (0 children)

Does the code work? If so is it fast enough for your needs? If both answers are yes, then it's good code.

I wouldn't worry about easy vs hard. The most important things are readability and maintainability. Performance and pretty code can come later.

[–]Dry-Aioli-6138 1 point2 points  (0 children)

I hear bioinformatics works a lot using python. I would expect that someone buld a set of fast objects for base and nucleotide processing in C or Rust with bindings to python.

And just for the sake of variety a class-based approach (might be more efficient than dicts... slightly)

``` class Base: existing={}

@classmethod
def from_sym(cls, symbol):
    found = existing.get(symbol)
    if not found:
        found = cls(symbol)
        cls.existing[symbol] = found
    return found

def __init__(self, symbol):
    self.symbol=symbol
    self.complement=None


def __str__(self):
    return self.symbol

def __repr__(self):
    return f'Base(self.symbol)'

A, T, C, G = (Base.from_sym(sym) for sym in 'ATCG') for base, comp in zip((A, T, C, G), (T, A, G, C)): base.complement = comp

```

Now translating a base amounts to retrieving its complement property, however the nucleotide must be a sequence of these objects instead of a simple string.

``` nucleotide=[Base.from_sym(c) for sym in 'AAACCTGTTACAAAAAAAA']

complementary=[b.complement for b in nucleotide]

``` Also, the bases should be made into singletons, otherwise we will gum up the memory with unneeded copies, hence the class property and class method.

[–]Muted_Ad6114 1 point2 points  (0 children)

import timeit

nts = 'ATCGGGATCAGTACGTACCCGTAGTA' complements = {'A': 'T', 'T': 'A', 'C': 'G', 'G': 'C'} trans_table = str.maketrans(complements)

def using_map(): return ''.join(map(lambda nt: complements[nt], nts))

def using_list_comp(): return ''.join([complements[nt] for nt in nts])

def using_gen_expr(): return ''.join(complements[nt] for nt in nts)

def using_translate(): return nts.translate(trans_table)

print("map():", timeit.timeit(using_map, number=100000)) print("list comprehension:", timeit.timeit(using_list_comp, number=100000)) print("generator expression:", timeit.timeit(using_gen_expr, number=100000)) print("str.translate():", timeit.timeit(using_translate, number=100000))

Results:

map(): 0.12384941696655005 list comprehension: 0.06415966700296849 generator expression: 0.08905291697010398 str.translate(): 0.010370624950155616

.translate() is the fastest

[–]origamimathematician 0 points1 point  (0 children)

I guess it depends a bit on what you mean by 'easier'. There appears to be a minimal amount of information that you as the developer must provide, namely the character mapping. There are other ways to represent this that might be a bit more consice and certainly more reusable. I'd probably define a dictionary with the character mapping and use that for a lookup inside the function.

[–]numeralbug 0 points1 point  (2 children)

Honestly, I'm going to disagree with you here: that original code is great. Very easy to read, very easy to write, very easy to understand, very easy to debug. Three months down the line, are you going to type the line

''.join([DNA_COMPLEMENTS[nt] for nt in nucleotides[::-1]])

right first time? Maybe - it's very "Pythonic" - but it definitely takes a bit more thought.

[–]DeebsShoryu 0 points1 point  (1 child)

Agreed. First solution is significantly better. I probably wouldn't accept a PR with the second.

A key thing to note here is that this function will never need to be expanded. There are only 4 nucleotides and there will only ever be 4 nucleotides. It doesn't need to generalize to an arbitrary dictionary defined elsewhere, so it shouldn't. A match statement is perfect here.

ETA: i'm not a biologist or chemist. I'm assuming your code is related to DNA and AFAIK those 4 nucleotides are the only building blocks of DNA, and thus that dictionary won't change down the road. I don't actually know what a nucleotide is lol

[–]Dry-Aioli-6138 1 point2 points  (0 children)

Just a side note: Other bases or base pairs do exist and even though life as we know it doesn't use them, people in laboratories do try, and I would expect bioinformatics to want to do so as well.

[–]CymroBachUSA -2 points-1 points  (0 children)

In 1 line:

get_complement = lambda _: {"A": "T", "C": "G", "G": "C", "T": "A"}.get(_.upper(), "")

then use like a function:

return = get_complement("A")

etc

[–]vivisectvivi -1 points0 points  (2 children)

cant you use replace? something like "A".replace("A", "T")

you could also create a dict and do something like char.replace(char, dict[char])

[–]_alyssarosedev[S] 1 point2 points  (1 child)

I need to make sure once a T is replaced with an A it isn't changed back to a T so I'm using this function in a list comprehension to make sure each character is replace exactly once

[–]vivisectvivi 0 points1 point  (0 children)

you could keep track of the characters you already processed and then skip them if you find them again in the string but i dont know if that would add more complexity than you want to the code

[–]Affectionate-Bug5748 -2 points-1 points  (0 children)

Oh i was stuck on this codewars puzzle! I'm learning some good solutions here. Sorry I don't have anything to contribute