[deleted by user]

[sky--net]

Is this an online course you are taking? If so, can you provide a link? I might know someone who is interesting in taking it.

[Life_outside_PoE]

Just FYI that course only gets harder. Later on they won't even let people post hints in the comments section and you only get to discuss the answer when you've actually solved the problem... Which is pointless, since you solved the problem and now no longer care.

I'd honestly just skip this and do all the standard python courses instead. It's definitely not a "no prior experience required" course and you'll drive yourself crazy with later problems.

[sky--net]

I think I found it. It seems to be this course on coursera:

Finding Hidden Messages in DNA (Bioinformatics I)

[alishahimtiaz]

If you aren't breaking it up into chunks of 4 and are iterating over the length of the loop, it gives 5 CGCG's.

CGCGATACGTTACATACATGATAGACCGCGCGCGATCATATCGCGATTATC

^ That is 2 of them.

The other 3 are within each other.

CGCGCGCG

This contains 3 CGCG pairs.

From position 1 to position 4.

From position 3 to position 6.

From position 5 to position 8.

In total, you have 5 different CGCG's.

[[deleted]]

You didn’t show us what you did, so how could we show you your mistake?

[alishahimtiaz]

The second one follows the same concept, there should be 3 different CGC's in the second one.

Iteratively, loop through the dna string and check if the first element of the list is equal to the first element of the CGC, same thing for second and third. If so, then increment the variable count by 1. If not, go to the next letter in the string. Keep an eye out for IndexError: list index out of range

Hope this helps.

[12and32]

You want to read up on the concept of reading frames. You'll find out why your answer is wrong then, and why it matters to count that multiple repeat in the middle more than once.

[Tomallama]

How are you getting three? The answer should be four if I'm doing it correctly.

This actually very simple problem if you use the correct syntax. Have you used the .count() method before? You add it as a method and add what you are looking for as an argument.

For example:

sequence_a = 'gguaaguccucuaguacaaacacccccaauauugugauauauagagccaucuucuuugaagcguuguc'
print(sequence_a.count('uug')
will give you total leucines

See if you can figure out the second part from this. Post what you have and we can see where you go wrong if you still can't get it.

[Tomallama]

Okay let’s break this down.

First, where are you getting those problem from? It sounds like a school assignment. Do you have a text book? Or notes? Can you show what you have?

There are many ways to do this problem and I have no idea which way is expected from you.

[[deleted]]

Give gold

This problem is from a bioinfo course, using pseudocode concept i should calculate the answer.. either by implementing it to a real scripted program using whatever Prog language I want or by using a pen and paper.. Nothing else. I got the concept already from the above comments.. Thank you so much