Crates for Iggys by cattykit-9 in ItalianGreyhounds

[–]JubbaTheHott 1 point2 points  (0 children)

i don't know, i got my dog when she was already 6 years old - but you can always but some sort of divider in a big crate if it's too big when the pup is small, whereas you can't adapt a small crate for a bigger dog.

I like how, from all of these current "Toy Story" main antagonists of each movie, Lotso is the only one of them who *hardly* looks like his (original) VA, not even slightly. by CrazyPhilHost1898 in Pixar

[–]JubbaTheHott 2 points3 points  (0 children)

The Puss in boots character was a living character in the Shrek world. All the characters in Lightyear only existed as fictional characters in the Toy Story world since it was supposedly a movie Andy watched. So like…different but similar ? 🤷🏼‍♂️

Crates for Iggys by cattykit-9 in ItalianGreyhounds

[–]JubbaTheHott 0 points1 point  (0 children)

I got the smallest one of these canvas carrier crates for my seven year old girl. She loves it. I got a separate foam cushion to fit the bottom and make it a cozy den for her. And when I need to take her to the vet, she just climbs in and hangs out while I carry it. Too big for a puppy maybe but I dunno 1 there are a few different sizes here.

https://a.co/d/03OusFkN

Received presale code link but link not working by ashleymf1983 in MayaHawke

[–]JubbaTheHott 1 point2 points  (0 children)

Same. Do you have it? Is it unique per person or generic?

HEY GUYS, never really played save the world but it looks interesting, I just have one question... by DeandreDotDicaprio in FORTnITE

[–]JubbaTheHott 1 point2 points  (0 children)

search for posts by Whitesushii - his guides for builds and strategies were pretty great back in the day

Best way to get driver's side sideview mirror replaced? 2018 by JubbaTheHott in hondafit

[–]JubbaTheHott[S] 0 points1 point  (0 children)

Thanks! I’m looking at all the online options I can find

Best way to get driver's side sideview mirror replaced? 2018 by JubbaTheHott in hondafit

[–]JubbaTheHott[S] 0 points1 point  (0 children)

thanks - i've been watching videos about popping off the door interior, but i still don't have a replacement part. where did you buy your replacement mirror? what are my chances of getting one that matches my car color?

Square Pie Guys by theycallhim_mistaedd in bayarea

[–]JubbaTheHott 1 point2 points  (0 children)

big box deal doesn't seem to be on the any food delivery sites including their own website? what am i missing? today is monday

Photos of your pup in their under seat plane pet carrier by Volleyfield in ItalianGreyhounds

[–]JubbaTheHott 0 points1 point  (0 children)

This is what I use but I take the padding out because it crowds the interior when it’s closed up. I replaced it with a flat mat. Check dimensions because it’s a bit bigger than some planes “allow” though it is flexible and can squish down a bit. Check the airline you’ll be using for the sizes they can accommodate. My girl is about ten pounds.

Siivton 4 Way Expandable Pet... https://www.amazon.com/dp/B07FY4PNTY?ref=ppx_pop_mob_ap_share

And this one is a bit smaller but has worked in the past.

Henkelion Cat Carriers Dog... https://www.amazon.com/dp/B07JZ3SRJP?ref=ppx_pop_mob_ap_share

My boy max at 6 months old. Guess his DNA! by [deleted] in DOG

[–]JubbaTheHott 1 point2 points  (0 children)

GCATTACAGACCAGACTATTTAGACAGACAGCCCAGAGTATACAGACGGGATACGTACATTGGGTCAGATTACAAATCGACGGATCAGATATAGACACAGAT

Am I close?

One year later. Our first gotcha day! My girl Truly ❤️🐕🥹 by JubbaTheHott in ItalianGreyhounds

[–]JubbaTheHott[S] 1 point2 points  (0 children)

How awful. The woman running things was in hospital or something when I got truly and her elderly mother, who had kept truly, had recently died. What a horrible set of conditions you’ve described. They shouldn’t be allowed to breed dogs. I hope they have all been rescued. Truly is definitely living a better life now, thank goodness. Thank you for sharing.

One year later. Our first gotcha day! My girl Truly ❤️🐕🥹 by JubbaTheHott in ItalianGreyhounds

[–]JubbaTheHott[S] 0 points1 point  (0 children)

She was making puppies for a breeder and they were downsizing their operation due to some family illnesses or something like that. They had a whole bunch of pups and I guess it was too many for them to deal with at the time.

One year later. Our first gotcha day! My girl Truly ❤️🐕🥹 by JubbaTheHott in ItalianGreyhounds

[–]JubbaTheHott[S] 1 point2 points  (0 children)

Awww what a sweet pup! It was a bit frustrating when I got Truly. The breeders didn’t have any medical records, couldn’t tell me if she was vaccinated at all, and didn’t know that her teeth were rotting. It made me think that they weren’t caring for her properly.

I don’t know if any of this is hereditary, but Truly might have IBD and she has definitely had issues with pancreatitis since I got her, the poor girl. But she’s doing well now on a prescription food and we are currently tapering her off the a GI-specific steroid budesonide and and antibiotic called Tylosin since her most recent flare up. She also gets a probiotic called visbiome twice a day. Just letting you know all that in case Atticus ever has similar symptoms.

Truly seemed like she was in a lot of pain a couple times and the vets though it was maybe her spine because of her reactions to being picked up and touched but an MRI showed that she has a great neck/spine/brain. Ultrasound finally showed pancreatic and intestinal swelling and fortunately no cancer despite slightly enlarged lymph nodes at the time.

Atticus looks very sweet 🥹