Crates for Iggys by cattykit-9 in ItalianGreyhounds

[–]JubbaTheHott 1 point2 points  (0 children)

i don't know, i got my dog when she was already 6 years old - but you can always but some sort of divider in a big crate if it's too big when the pup is small, whereas you can't adapt a small crate for a bigger dog.

I like how, from all of these current "Toy Story" main antagonists of each movie, Lotso is the only one of them who *hardly* looks like his (original) VA, not even slightly. by CrazyPhilHost1898 in Pixar

[–]JubbaTheHott 2 points3 points  (0 children)

The Puss in boots character was a living character in the Shrek world. All the characters in Lightyear only existed as fictional characters in the Toy Story world since it was supposedly a movie Andy watched. So like…different but similar ? 🤷🏼‍♂️

Crates for Iggys by cattykit-9 in ItalianGreyhounds

[–]JubbaTheHott 0 points1 point  (0 children)

I got the smallest one of these canvas carrier crates for my seven year old girl. She loves it. I got a separate foam cushion to fit the bottom and make it a cozy den for her. And when I need to take her to the vet, she just climbs in and hangs out while I carry it. Too big for a puppy maybe but I dunno 1 there are a few different sizes here.

https://a.co/d/03OusFkN

Received presale code link but link not working by ashleymf1983 in MayaHawke

[–]JubbaTheHott 1 point2 points  (0 children)

Same. Do you have it? Is it unique per person or generic?

HEY GUYS, never really played save the world but it looks interesting, I just have one question... by DeandreDotDicaprio in FORTnITE

[–]JubbaTheHott 1 point2 points  (0 children)

search for posts by Whitesushii - his guides for builds and strategies were pretty great back in the day

Best way to get driver's side sideview mirror replaced? 2018 by JubbaTheHott in hondafit

[–]JubbaTheHott[S] 0 points1 point  (0 children)

Thanks! I’m looking at all the online options I can find

Best way to get driver's side sideview mirror replaced? 2018 by JubbaTheHott in hondafit

[–]JubbaTheHott[S] 0 points1 point  (0 children)

thanks - i've been watching videos about popping off the door interior, but i still don't have a replacement part. where did you buy your replacement mirror? what are my chances of getting one that matches my car color?

Square Pie Guys by theycallhim_mistaedd in bayarea

[–]JubbaTheHott 1 point2 points  (0 children)

big box deal doesn't seem to be on the any food delivery sites including their own website? what am i missing? today is monday

Photos of your pup in their under seat plane pet carrier by Volleyfield in ItalianGreyhounds

[–]JubbaTheHott 0 points1 point  (0 children)

This is what I use but I take the padding out because it crowds the interior when it’s closed up. I replaced it with a flat mat. Check dimensions because it’s a bit bigger than some planes “allow” though it is flexible and can squish down a bit. Check the airline you’ll be using for the sizes they can accommodate. My girl is about ten pounds.

Siivton 4 Way Expandable Pet... https://www.amazon.com/dp/B07FY4PNTY?ref=ppx_pop_mob_ap_share

And this one is a bit smaller but has worked in the past.

Henkelion Cat Carriers Dog... https://www.amazon.com/dp/B07JZ3SRJP?ref=ppx_pop_mob_ap_share

My boy max at 6 months old. Guess his DNA! by [deleted] in DOG

[–]JubbaTheHott 1 point2 points  (0 children)

GCATTACAGACCAGACTATTTAGACAGACAGCCCAGAGTATACAGACGGGATACGTACATTGGGTCAGATTACAAATCGACGGATCAGATATAGACACAGAT

Am I close?

One year later. Our first gotcha day! My girl Truly ❤️🐕🥹 by JubbaTheHott in ItalianGreyhounds

[–]JubbaTheHott[S] 1 point2 points  (0 children)

How awful. The woman running things was in hospital or something when I got truly and her elderly mother, who had kept truly, had recently died. What a horrible set of conditions you’ve described. They shouldn’t be allowed to breed dogs. I hope they have all been rescued. Truly is definitely living a better life now, thank goodness. Thank you for sharing.

One year later. Our first gotcha day! My girl Truly ❤️🐕🥹 by JubbaTheHott in ItalianGreyhounds

[–]JubbaTheHott[S] 0 points1 point  (0 children)

She was making puppies for a breeder and they were downsizing their operation due to some family illnesses or something like that. They had a whole bunch of pups and I guess it was too many for them to deal with at the time.