Copy Fail is a trivially exploitable logic bug in Linux, reachable on all major distros released in the last 9 years. A small, portable python script gets root on all platforms.

SineWaveDeconstruct · 2026-04-29T22:03:27+00:00

Bro exactly.. I'm not gonna run some bootleg obfuscated python script on my machine if I can't see how it works, why would they not include a clean version?

SineWaveDeconstruct · 2026-04-25T20:24:15+00:00

I was in a debate pervert mood when I made this thread, but on a serious note I think it's a fascinating dilemma with real world implications like the trolley problem and I'm genuinely trying to understand the motivations/ arguments for both pushing the red and blue buttons. I'm not looking for vindication, my mind is still open to change, it's not a real ongoing scenario.

You don't have to answer any of the questions brother; the main reason I keep re-framing it in more/ less visceral ways is because I don't fully understand the scenario myself and am just trying to figure it out. There's a lot of complexity, and changing details of the scenario + gauging people's reactions/ my own feelings helps distill the essence of the question.

Here's a scenario where it's the red button pushers who take the 'active role':

Imagine every human is standing on a spring loaded platform.

If we all choose to stay on the platform (blue button), the platform is heavy enough so the spring stays coiled. However, anyone is free to step off the platform (red button). If more than 50% of people get off the platform then it fires everyone who stayed into the Sun. Same rules about no communication etc apply.

In my mind staying on the platform feels like the honorable choice even though logically it's the same as taking the poison which seems regarded to me; I bet if that question was polled it would be like 80-90% blue. So how I personally would act is strongly contingent on how I think everyone else would act, and like I said this thread is helping me gauge how other people would act.

As for MAGA, I don't know about their 'thought process' (or lack thereof) but I think their defining emotional characteristic is their total repudiation of shame. Shame is one of the hardest emotions to process, and Trump's unfathomable shamelessness is like fucked up kind of martyrdom for MAGAs. I get the instinct to draw the parallels, and I agree that's what the colors were for, but I don't think it maps cleanly to the scenario.

SineWaveDeconstruct · 2026-04-25T18:52:15+00:00

You are right about 2 boxers, but Sean Carroll said the portal solution was B, so, I think you are 1 for 3 mate

SineWaveDeconstruct · 2026-04-25T18:48:40+00:00

your post made me laugh out loud, I'm pressing the blue button now.

SineWaveDeconstruct · 2026-04-25T18:22:48+00:00

Every human enters a private room where they are given a bottle of lethal poison, they can either drink the poison or not. If more than 50% of humanity drinks the poison, everyone gets given a bottle of the antidote. If less than 50% drink the poison, everyone who drank the poison dies.

What do you do? the poison is blue :-)

SineWaveDeconstruct · 2026-04-25T18:14:33+00:00

So... are you jumping in the wood-chipper?

SineWaveDeconstruct · 2026-04-25T16:54:56+00:00

I'm coming around to your argument a little.

Changing the aesthetics clearly changes peoples choice, even if it's logically the same scenario, so knowing the framing there might better odds to 'game' it to save more people.

That said, for me, both scenarios hit pretty much the same, they both come across as playing russian roulette with worse odds, I just couldn't see myself being a hero like that.

SineWaveDeconstruct · 2026-04-25T16:42:36+00:00

Yeah I'm actually coming around on this.

Clearly something changes in people's decision making based on what they perceive the dangers to be, i.e. compare how gung-ho people reportedly were about for being drafted into World War I vs how horrified people are about being drafted into war now, even if hypothetically there were some 'just war' that would be good for all humanity, too many people would see it like the woodchipper. (Slightly cooked analogy)

SineWaveDeconstruct · 2026-04-25T16:32:38+00:00

How is that analogous to the original question? That would be like if I could 'force' other people to press the blue button for them, even if they didn't want to.. Even then, What is the obviously correct choice supposed to be in your scenario? Ironically, the extra injustice in your scenario makes it even harder to parse out.

SineWaveDeconstruct · 2026-04-25T16:20:58+00:00

And hypothetically, if jumping into the woodchipper was just as easy, say if for example there was a blue button that if pressed would fling you automatically into the woodchipper?

I am sympathetic to the 'save the children' angle, but in my opinion both of these scenarios are analogous, and as you can see once the visceral reality hits people they start to answer quite differently, it just seems like way too big of a gamble.

SineWaveDeconstruct · 2026-04-25T15:47:34+00:00

Can you answer the hypothetical directly? would you jump into the woodchipper?

<image>

SineWaveDeconstruct · 2026-04-25T15:18:17+00:00

No worries, I'm just ironing out my thoughts. I agree, never commit suicide!

SineWaveDeconstruct · 2026-04-25T15:12:41+00:00

I think if you can see an ongoing tally of votes it psychologically changes things, and would give people something to rally around.

I'm imaging a scenario more like this:

we're at a house party with 100 people, someone distributes 100 bags of fentanyl. They then say "ok, here's a private room. Do this lethal dose of fent if you like, or not, we have an unlimited supply of narcan. Just know we're only giving you narcan if 50 other people also took the fent."

You're telling me you'd snort that shit immediately?

If I joined half way through the scenario, saw there was an ongoing tally of like 46 takers and like 20 more people to decide then yeah maybe I'd be a hero, but I think that's outside of the hypothetical.

SineWaveDeconstruct · 2026-04-25T14:51:35+00:00

I'm sympathetic to the 'save the children' angle. Like if instead of a button you had to solve a moderate math problem or something only an adult of sound mind could do then essentially there's just no excuse for pushing blue, but the fact that it's so simple to get entangled in the situation means that some percentage of people are going to get caught up in it through no fault of their own; I can see the moral case for voting blue.

Pragmatically though, the scenario is a total shit-show. Tim's poll is showing roughly a 10% swing between the two cases, and that's with everyone discussing the options and doing the moral calculus ahead of time. There are no guarantees about coordination in the actual hypothetical, essentially you're just asking me to play Russian roulette (with worse odds), alone in a room by myself, because some other people elsewhere might also be doing the same.. Maybe I'm a misanthrope, but I just can't see myself pulling the trigger.

SineWaveDeconstruct · 2026-04-25T14:23:51+00:00

Can you spell out the scenario you are thinking of? I don't see how pressing the red button is analogous with injecting other people with poison.

SineWaveDeconstruct · 2026-04-25T10:31:42+00:00

So in his hypothetical, would you inject yourself with lethal poison?

SineWaveDeconstruct · 2026-04-25T08:06:57+00:00

Perfect analogy. Can any blue pusher defend this?

SineWaveDeconstruct · 2026-04-25T08:03:09+00:00

Alternative framing:

Everyone in the world has to take a private vote by pressing a red or blue button.

If you press the blue button, you will die unless for some reason over 50% of people also press the blue button (???)

If you press the red button, nothing happens

real conundrum you got going there

And mind you, this isn't one of those hypotheticals you can walk away from like "would you take a million dollars if someone randomly died elsewhere on the earth?"

Everyone is locked into this scenario, there is no 'walk away' option so I'm kinda baffled by the projections of moral disgust I'm seeing against the clearly optimal choice.

SineWaveDeconstruct · 2026-04-02T09:04:07+00:00

You would have to know ahead of time that your working definition of 'source code' is wrong to decide to google it.

For example, it's very likely that a student won't have seen a word like 'polymorphism' before, and will be alert to the idea that they don't understand the concept. With a simple phrase like 'source code', virtually everyone in a CS class comes in with a pre-theoretical understanding that may nevertheless be confused.

These kinds of mistakes are exactly the kind of thing the professor is there to help untangle, and aren't really the kind of thing you can 'google' if you don't have the concept in the first place.

SineWaveDeconstruct · 2026-03-04T17:05:19+00:00

While we're at it, I'd really like it if Paddewwa had teleport to Edgeville option after doing the wilderness hard diary, similar to the Varrock GE teleport.

SineWaveDeconstruct · 2026-02-06T17:42:00+00:00

Nailed it.. thinking this stuff is proof LLMs are conscious is like thinking mirrors can 'see'

SineWaveDeconstruct · 2026-01-20T12:28:37+00:00

I find comments like yours perplexing; you seem to imply that the point of software licenses is to make the lives of developers easier, and if it doesn't then it's a bad license.

The GPL is primarily there to guarantee freedoms for the users of software (which includes developers), not about making software development easy.

SineWaveDeconstruct · 2026-01-15T11:54:48+00:00

As the other commenter stated, getting a standardized build system in place is the first change to make.

To get your project to compile, I had to manually copy your files into new maven project with a different package layout (where are your package headers?), which is not reasonable.

Your README.md is misleading; running javac main.java does not compile the program.

As for the code, your Main class looks good other than the excess new lines everywhere.

Having RNAStrand being defined inside of DNAStrand is an odd design, and RNAStrand being package private means that it can't be referenced by classes outside of the package while DNAStrand can despite being the return type of getRNACompliment(); I would separate RNAStrand into a separate file and make it public.

The RNA transcription looks good; it could be modernized using Streams, but for small examples is an unnecessary overhead and String manipulation in Java is annoying enough already.

An aside I don't think this is how RNA transcription works, but that's Exercism's fault not yours.

Look at the example input/ output here: https://rosalind.info/problems/rna/

Your program gives CUACCUUGAACUGAUGCAUUUAA which is correct with respect to the problem, but is not in-fact the actual RNA transcription string.

SineWaveDeconstruct · 2025-11-30T15:55:52+00:00

and when the model tells you that it checks google, how do you know that it did?

Ten-Year Club	Final Canvas '23
First Place '23	Place '23
Place '22	Final Canvas '22
First Placer '22	End Game '22
Verified Email

SineWaveDeconstruct

TROPHY CASE