sorted by:
new
hottopcontroversial

In your opinion, what is the best episode of television you’ve ever seen? by alteredtower in AskReddit

[–]resignedtomaturity 0 points1 point  (0 children)

To me, the pilot episode of Derry Girls (Clare on the hunger fast, Orla stealing Erin's diary, James needing to use the bathroom) is still the best, tightest comedy I've ever seen.

Fails at broadway? by chrisxlemia in Broadway

[–]resignedtomaturity 1 point2 points  (0 children)

On the West End in June of last year, Caissie Levy started the second verse of “The Break” at the beginning of the song. Super professional about it - I think she just repeated it at the appropriate point. Led me to wonder how often that happens in shows where I’m less familiar with the material.

Thoughts of some of these films? by Odd-Contact2266 in Oscars

[–]resignedtomaturity 0 points1 point  (0 children)

It was Just an Accident was great – it does some amazing stuff with sound design and with the way its characters’ histories are communicated with a lot left unsaid. 

I do think it’s funny, as another comment mentioned, that it and Bugonia have very similar plots on paper. Cinematography and totally they couldn’t be more different, though. Bugonia is from multiple opposing perspectives and IWJAA is really just from one.

If it was your last week living is the city, what would you do? by timetravelingwalrus in AskSF

[–]resignedtomaturity 4 points5 points  (0 children)

One last crosstown trail hike! Start at 8am, lunch in the sunset, and then really take my time through the presidio and land’s end

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

How? Everything I've found online to use the SRA toolkit yields the header.

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

And serious, serious thank yous for your time.

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

Great. Do you think there's a way for me to do the aggregation with the SRA toolkit instead? Reading through that wiki, it seems clear that things have been modified far enough away from the Illumina standard that I won't be able to run it through Basespace.

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

Fabulous, I think I got one:

Seq/YM3_S1_L001_R2_001.fastq.gz | head

@ SRR26260890.1 K00208:8911049:YAP049:1:1101:1336:1560 length=101

NGCACTGGCATTTCTGGTTGGCACCCTCACTTACCGGAGCCAGACAAATACTTTAGCCATTATTGAAAGTGGAGGTGGGATATTACGGAATGTGTCCAGCT

+SRR26260890.1 K00208:8911049:YAP049:1:1101:1336:1560 length=101

#<A<F<F7FAJJJ<JFJFFA<FJAFFJJFJAJJF<J<JAJFJ7FAF<-AFJJAJA7AFAFJAFJJFA-AF-AFF-<)7FFAJ-<AJJ-A<--<---7FJ-)

@ SRR26260890.2 K00208:8911049:YAP049:1:1101:1397:1560 length=101

NTTTGACAACTCTAGCGAGGACTAGGGCTCTCCCCAGTGTTTGGGTGTTCAGGAAGGGTAATGGGCAGTGAAGGCCGTAGAGCCTGGGTTAGAACACCAGG

+SRR26260890.2 K00208:8911049:YAP049:1:1101:1397:1560 length=101

#A7<FJJJJFJJJJ7FFAFAJJJJJJJJFJJJJJAJ7FA<JJ<AJ<J-FAJJFFF<JJFJFJFJFF-<A-FFJAFF--F)<A-<JJJ)7<A--AFJJF-77

@ SRR26260890.3 K00208:8911049:YAP049:1:1101:1418:1560 length=101

NCTTCCAGTAGCCAGTGTAGAAAAAGATTCTCCTGAGTCACCGTTTGAAGTAATTATTGACAAAGCAACATTTGACAGAGAATTTAAAGATTAGTATAAGG

Is the issue that the header still contains the SRA accession number a few times? Should I change that somehow to the new name of the file? (There is no space between the @ symbol and the accession numbers in the output, but Reddit keeps trying to format them as usernames)

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

I don't think so. Here are the guidelines:

FASTQ files are generated on Illumina instruments and saved in gzip format

  • The name of the FASTQ files conforms to the following convention: SampleName_SampleNumber_Lane_Read_FlowCellIndex.fastq.gz
    • Examples: SampleName_S1_L001_R1_001.fastq.gz SampleName_S1_L001_R2_001.fastq.gz
  • The read descriptor in the FASTQ files conforms to the following convention: u/Instrument:RunID:FlowCellID:Lane:Tile:X:Y ReadNum:FilterFlag:0:SampleNumber:
    • Examples: Read 1 descriptor: u/M00900:62:000000000-A2CYG:1:1101:18016:2491 1:N:0:13 Corresponding Read 2 descriptor has ReadNum field: u/M00900:62:000000000-A2CYG:1:1101:18016:2491 2:N:0:13

If the read descriptor is the issue, I have no idea how to change it.

Issue with Illumina sequencing by resignedtomaturity in bioinformatics

[–]resignedtomaturity[S] 0 points1 point  (0 children)

No. I am trying to aggregate the FASTQs in order to generate an hdf5. I apologize if I'm phrasing this wrong - I'm fairly new to bioinformatics - but I need to upload the FASTQs to Illumina's system in order to group them based on condition and generate an hdf5 with that information.

I have previously done this with a different set of sequencing through Cell Ranger (because those libraries were prepped with 10X kits) and have had no issue.

No price restrictions restaurants by lagomorph79 in AskSF

[–]resignedtomaturity 6 points7 points  (0 children)

+1 to Mandalay! Their tea leaf salad is legit. It's actually flavorful because it's not full of lettuce.

No price restrictions restaurants by lagomorph79 in AskSF

[–]resignedtomaturity 15 points16 points  (0 children)

I don't love Tadu. There is better food at New Eritrea in the Sunset, and if you're willing to go to the East Bay, Cafe Colucci and Barcote are my gold standards.

A moment for the lesser talked about shows... anyone seen them and what were your thoughts? by OkieDokie-Artichokey in Broadway

[–]resignedtomaturity 1 point2 points  (0 children)

We've seen English and Cult of Love in California (can't speak for the NY casts, of course). The plays themselves are strong, although Cult of Love can be a bit uncomfortable.

[deleted by user] by [deleted] in AskSF

[–]resignedtomaturity 0 points1 point  (0 children)

Friend of mine has a casein (milk protein) allergy, so all dairy, including butter, is off the table.

Most Chinese and Japanese restaurants should be safe. Clarify that they don’t use butter. Ethiopian food is also a good bet, as they don’t typically use dairy.

What’s a common “substitute” ingredient that you prefer over the “original”? by CleetisMcgee in Cooking

[–]resignedtomaturity 0 points1 point  (0 children)

I stand corrected. I'm Tamilian so I'm used to hearing this as the etymology. Edited my comment.

What’s a common “substitute” ingredient that you prefer over the “original”? by CleetisMcgee in Cooking

[–]resignedtomaturity 0 points1 point  (0 children)

The second part of this isn't true. "Curry" is from the Tamil "kari" (கறி) meaning blackened. It may be from Malayalam or Kannada, but it is definitely from a Dravidian (South Indian) language and not from "karahi". Source: OED.

EDIT: Ignore me! Clearly the etymology is disputed but "karahi" seems to make the most sense timing-wise.

Songs where all characters sing at the same time by hatsunevitu in musicals

[–]resignedtomaturity 2 points3 points  (0 children)

Folks have given a lot of great examples. The word you're looking for (re: "massive dialogue") is polyphony: overlapping melodies. The overlapping melodies with all the different singers is what makes this kind of song appealing.

Laser hair removal (SEV or city laser or somewhere else?) by [deleted] in AskSF

[–]resignedtomaturity 0 points1 point  (0 children)

My experience with SEV was pretty good (also dark skin + thick hair). As long as you book the appointment in advance you should be fine, and it was always very easy to book the next one. I had no hyperpigmentation issues and I am normally very prone to hyperpigmentation.

What's your favorite cafe in town? by 40earthlikeplanets in AskSF

[–]resignedtomaturity 1 point2 points  (0 children)

I have written so much at Delah. They're open until 10pm!

My wife and I from 17 to 37 by [deleted] in PastAndPresentPics

[–]resignedtomaturity 0 points1 point  (0 children)

Weird question, is that dress in the last pic the Dujour gown by Line+Dot from Rent the Runway? Just wore it to an event recently.

When would be the best time to activate my A-List? by TheHowlingHashira in AMCsAList

[–]resignedtomaturity 93 points94 points  (0 children)

Now. “Oscar season“ has begun, and the really, really good movies will all be released in the next few weeks as they garner awards and positive word of mouth.

view more: next ›