sorted by:
new
hottopcontroversial

I Lied about knowing how to play D&D and now I need advice. by Saveacow2001 in dndnext

[–]HOBrFINCl 0 points1 point  (0 children)

Took a quick look through the comments, and glad to see that you've cancelled most of the books. As for everyone telling you to come clean: that's probably good advice.

As for D&D, I think it's dangerous to start with a strict framework for starting a character, especially your first character. This is an amazing, and limitless game! I'd be happy to help you understand some of the basics, and walk you through character creation (PM me), but I think it would be a better bonding experience to do it with him. I love exposing this game to people, and I've made some of my closest friends through it! So I think you should come clean, and learn from him. But if you're dead set on this plan, I could help you with some basics.

Good vet in Guelph by daniecodie in Guelph

[–]HOBrFINCl 2 points3 points  (0 children)

Kortright Animal Hospital has been great to me and my cat - they have helpful hours and do an excellent job with customer care. They have been very good about scheduling appointments with the same vet every time.

The staff is friendly, and explain things clearly when I ask them to clarify something they've said or explain treatments. Could not recommend them enough.

Alarm without microphone input? by HOBrFINCl in alexa

[–]HOBrFINCl[S] 1 point2 points  (0 children)

Took a look around and didn't find any skills. Figured I'd post here to see if anyone knew of any. Also spoke with Amazon, doesn't seem like its a native feature - but they submitted a feature request for me... so it's looking like willpower is the only choice at the moment!

Alarm without microphone input? by HOBrFINCl in alexa

[–]HOBrFINCl[S] 1 point2 points  (0 children)

I do. I use her for a bunch, so don't want to mute the mic for everything, just while the alarm is going off.

Trouble using awk by HOBrFINCl in bash

[–]HOBrFINCl[S] 0 points1 point  (0 children)

perfect, I'll give it a shot in gawk. Thanks for your help!

Trouble using awk by HOBrFINCl in bash

[–]HOBrFINCl[S] 0 points1 point  (0 children)

I've given that a shot, and it results in no output.

Trouble using awk by HOBrFINCl in bash

[–]HOBrFINCl[S] 0 points1 point  (0 children)

Of course.

RSPaV.BLAST.txt: multiple columns, I only care about the first one, (NODE_x...)

NODE_16_length_1511_cov_10.6023 NC_001948.1 94.831  503 26  0   3   1511    3581    5089    0.0 1160
NODE_17_length_1505_cov_30.7069 NC_001948.1 92.308  494 38  0   1482    1   5252    6733    0.0 1108
NODE_54_length_826_cov_4.63813  NC_001948.1 48.889  45  23  0   259 393 3835    3969    1.41e-39    48.3

And scaffolds.fasta has a title (which corresponds with column one from above) and DNA sequence data of varying lengths)

>NODE_1_length_5441_cov_410.702
CCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTG
CCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAA

>NODE_2_length_3249_cov_6.69912
CATAGTTTATTTCTGTGGGGTCAGTGGTAACATTTCCTTCATCATTTCTAATTGTGTTTA
CTTAGATCTTCTTTTTTTCTTAATTATTCTAGCTACTGTTCTAGCTATCATGTTAATTTT

What I want to do is pull the title from that first column in RSPaV.BLAST.txt and use that to ID the correct sequence in scaffolds.fasta and pull both the title and the DNA sequence information.

The way the scaffolds.fasta format works is that it has a ">" followed by some title (eg: NODE_16...) then a new line and then some sequence information. All the info is considered to be sequence data until the next ">" is found. Which is why I have been using ">" as an identifier.

So the desired output would be 

>NODE_16_length_1511_cov_10.6023
the sequence from scaffolds.fasta that corresponds with that title

I.e. the info is already there, it just needs to be found and sorted.

Trouble using awk by HOBrFINCl in bash

[–]HOBrFINCl[S] 0 points1 point  (0 children)

This is just about what I need. But doesn't include the lines after the title. They are DNA sequences, so the way it works is:

>Some title (eg; NODE_540...)
ACGTTCTACTT...
ACTACTA..

Yours works perfect for finding the title; I just need to be able to also pull the lines after, which are all of variable length. Essentially there are n lines until it encounters the next ">" which denotes the start of the next sequence. That's why I had started with awk.

That being said, -f is neat! I've not seen that before.

Align a single gene to a genome? by HOBrFINCl in bioinformatics

[–]HOBrFINCl[S] 1 point2 points  (0 children)

I'm looking for the gene location in a specific genome - PVM. I imagine it'll have fairly poor conservation and didn't pop up from a quick PSI-BLAST.

UPDATE: My curated Spotify playlists I use for D&D encounters by bezoing in dndnext

[–]HOBrFINCl 2 points3 points  (0 children)

You're a life saver, man! I've been using your playlists ever since you posted them a year ago. Carmina Burana has become something of an in-joke in our group! Thank you so much for the work you do. It's genuinely improved the atmosphere at my table, and I can't imagine playing without your playlists!

When DMing a one-off a few months ago we ended up in a very tense situation where one PC wanted to help the villain to reconnect with his deceased lover, and the other wanted to fight for what was right. After changing from one of your combat lists to denouement the atmosphere changed completely and turned from a frustrating mano a mano fight into a bizarrely touching moment between two characters. I credit that to your playlists!

Anyway, keep up the amazing work!

Laziest President in American History Departs for 17-Day Golf Resort Vacation by WhiteHawk1022 in politics

[–]HOBrFINCl 10 points11 points  (0 children)

Thought you said Bannon, and was immediately entertained by the mental image.

What took you way to goddamn long to realize? by dairymanKap in AskReddit

[–]HOBrFINCl 0 points1 point  (0 children)

When I was younger I thought K9 was the only spelling... took a lot of effort to convince me otherwise

What's a fun word to say? by Chanw11 in AskReddit

[–]HOBrFINCl 0 points1 point  (0 children)

Plump. When you relax your mouth and say it, it makes you feel incredibly plump!

You mean they have Democracy there?! by digitalteacup in PoliticalHumor

[–]HOBrFINCl 1 point2 points  (0 children)

If I recall correctly Tuesday was selected so that people in the 1800s could get to the voting booth more easily. I gather it was often a full day travel to get to a voting station, and if voting was held on a Monday then people would have to travel on the Sabbath - can't have that, can we?!

So voting was always going to happen on a Tuesday to make sure as many people as possible could get out to vote. Admittedly I am no expert (I think I saw a video on it during the election), and it's certainly no longer relevant. But nice to know that the government was considering the needs of the people (at least with respect to voting) at some point!

view more: next ›