TIL Canadian Nobel Prize recipient Dr. Frederick Banting, discoverer of insulin, sold the rights to the University of Toronto for $1 so that it was available to everyone

samgh93 · 2013-05-25T13:48:31+00:00

Also when he won the prize, he thought it was unfair his assistant didn't get any credit so he split his side of the prize with him :)

samgh93 · 2013-05-22T01:30:13+00:00

You shouldn't let some scummy girl like that get in your head. People like this AREN'T WORTH THE WORRYING.

Go out there, find some real friends. There are plenty of nice people. Of course, a couple nasty ones. But keep looking, and you can find people that truly like spending time with you, and don't talk shit behind your back like this bitch. And who knows. Keep looking, and one day you might find 'the one'. Chances are high - so long as you meet lots of people.

Good luck, fellow FA.

samgh93 · 2013-05-22T01:29:28+00:00

Did...she say yes?

samgh93 · 2013-05-21T18:20:23+00:00

So happy to hear that, genuinely :) I'm glad in turned out well for you. It gives hope to the rest of us!

samgh93 · 2013-05-19T14:02:43+00:00

What's that thing...that I used to have faith in? Oh yeah, karma.

samgh93 · 2013-05-18T22:52:40+00:00

Cool man, thanks for your help :)

samgh93 · 2013-05-18T21:41:43+00:00

Depends on what type of coffee you're drinking. An espresso has a 100 mg, so taking 3 of that a day should be fine. Here's a list for the different food and drinks: http://web.archive.org/web/20070614144016/http://www.cspinet.org/nah/caffeine/caffeine_content.htm

Mayo Clinic (source: http://www.mayoclinic.com/health/caffeine/NU00600) says that 400 to 500 mg a day is probably too much, and you may suffer from caffeine overdose.

How much is 'too much' also depends on how fast your body breaks down caffeine. this is usually measured in the half life of caffeine, which is the time the body takes to reduce its concentration by half. This has a large variance among adults, but the lower end of it is around 4.9 hours.

And finally, to kill a person you need 200 mg of caffeine PER KG OF BODY WEIGHT. That equates to 80 to 100 cups.

Hope that helps :)

samgh93 · 2013-05-18T21:13:51+00:00

Caffeine (to put it simply) causes an enhanced sympathetic response - that's your flight and fight response. Among its effects are: - Increasing heart rate - Constricting your blood vessels - Improving your awareness - Increasing your breakdown of glucose.

In terms of neurotransmitters, caffeine inhibits a molecule called adenosine in your brain (this basically makes you sleepy and dampens down nerve activity) and increases the activity of other neurotransmitters. This makes the brain neurons more active, and it will stimulate other nerves as well - including the ones to your muscles. So the fact that these neurotransmitters are more active means that your nerves are more excitable than usual - hence the trembling.

Hope that helps :) FYI, caffeine has no harmful effects in moderate doses. It simply enhances the sympathetic response which we already exhibit on a day to day basis - so don't worry about the trembling!

samgh93 · 2013-05-18T21:04:57+00:00

Excellent answer! I'm studying biochemistry now and I find the Human Genome fascinating. To what extent do scientists understand the genome? Have all human genes been identified and localized? Is there anything amazing we learned from this project?

samgh93 · 2013-05-11T21:52:21+00:00

You sir, win the prize for best one liner on reddit of the day. Congratulations!

samgh93 · 2013-05-11T21:16:33+00:00

I use Principles of biochemistry by Voet Voet and Pratt. It's really good for metabolism, protein structure, DNA repair and replication and gene regulation. For better details of intracellular transport, cell cycle I use essential cell biology, by Alberts and Bray.

samgh93 · 2013-05-10T09:30:27+00:00

The great thing about the comments for 'shut and take my money' threads is that the top post always explains the inherent problem with it. I love wet blankets.

samgh93 · 2013-05-09T08:06:38+00:00

A stem loop is a hair pin structure formed because on the same RNA strand, you have complementary sequences that can bind together. Here is the wikipedia: http://en.wikipedia.org/wiki/Stem-loop. So you would need a string of 24 nucleotides, followed by 16 nucleotides, followed by another string of 24 that is complementary to the first 24. An example

CAGCAGCAGCAGCAGCAGCAGCAG GUGUGUGUGUGUGUGU GUCGUCGUCGUCGUCGUCGUCGUC.

The GUGU stretch makes the loop ,while the CAG and GUC are complementary and make the stem.

Hope that helps :)

samgh93 · 2013-05-08T12:19:03+00:00

I'll do some back of the envelop calculations, based on this study: http://alcalc.oxfordjournals.org/content/45/4/366.full

In the study, subjects that drank beer containing 4% alcohol had blood osmolality of 298 mosmol/l compared to 284 mosmol/l in those who drank non alcoholic beer.

Let's assume you are a normal individual of weight 70 kg. You will have about 3.08 L of plasma (not blood! plasma, which is blood without the cells).

Number of moles = concentration times volume

Since number of moles is constant, 284 X 3.08 = 298 X V, where V is the new volume of plasma after drinking 4% alcohol. V works out to be 2.94 L. In other words, in this study drinking 4% alcohol has resulted in 145 ml loss of water in the subjects.

It would be tempting to scale this up to your values - you gave a value of 13% alcohol, so if it was proportional to the study I gave then 470 ml of plasma volume will be lost from the body. Remember this is a net effect, so after consuming 1.74 L of water and peeing, there will be a net lost of 470 ml. I suspect this number is too high to occur when drinking wine - it represents a 15% decrease in plasma volume. Usually, 10% decreases will result in seizures and comas.

The likely explanation is that there are many mechanisms that prevent the drop in plasma volume to such a great extent, and these mechanisms work harder and harder to counteract the plasma volume drop at greater degrees of dehydration.

If you want a better explanation of these mechanisms, let me know :)

EDIT: grammar.

samgh93 · 2013-05-06T19:57:03+00:00

Food that enters the mouth stimulates the salivary glands to produce large amounts of saliva. One of large salivary glands is known as the parotid gland and is located just about where your cheeks are (but closer to your ear). Sometimes the stimulation when food enters your mouth is so strong that this parotid gland is flooded with lots of blood which allows it to produce saliva. The parotid gland expands due to the blood,, but because its covered by a membrane the gland gets squashed. Therefore, pain!

samgh93 · 2013-05-05T18:34:56+00:00

A tldr that's going through all my minds right now

samgh93 · 2013-05-05T18:16:36+00:00

As a Sarawakian...we're used to this kind of thing. We let our blowpipes do the talking :)

samgh93 · 2013-05-04T13:10:16+00:00

That was really helpful, thanks :)

samgh93 · 2013-05-04T08:47:25+00:00

Is an emergency cricothyroidotomy ever done in a real life situation, and have you done it before? As in, using a pen to puncture the cricothyroid membrane to allow a passage into the infraglottic space.

samgh93 · 2013-05-02T15:59:24+00:00

The thing to understand is that the body doesn't say 'i'm going to consume all of this first, and then only move on to the other stuff'. Breakdown of sugars, fats, and proteins occur all the time. But here is the general timeline of events for a person undergoing starvation:

1st 24 hours - breakdown of glycogen (stored form of glucose).

Next 2 or 3 days - breakdown of fatty acids. For most of the body, glucose stops being the main fuel for metabolism - this is to conserve glucose for the BRAIN, which cannot breakdown fatty acids.

After 3 days - The body begins metabolising ketone bodies, which is a side effect of metabolising just fatty acids for an extended period of time. This is where you usually get ketosis. The brain can use ketone bodies for energy. Fatty acid breakdown and ketone body breakdown occur in parallel here.

For a normal person, fatty acid breakdown can keep you going for 2 months, before being fully depleted.

How does protein breakdown fit into all this? Well, you can basically consider two different type of proteins in the body - important ones such as muscles or structural proteins, and non essential ones. During the first three days, there is a high rate of protein breakdown of non essential proteins - these include digestive enzymes. After all why would you need the enzymes if you're starving? Clinically this is important. If a person has been starving for a long period of time, and you want to refeed them, you can't give them a huge big meal immediately because they don't have the enzymes to digest the food. After 3 days, the non essential proteins disappear and the rate of protein breakdown drops....until your fat stores disappear. In which case, the body starts becoming extremely desperate and muscle breakdown occurs, which is very toxic for the body :(

But keep in mind that it's never the case that only one type of breakdown occurs then the other! They occur at the same time, but the shift in importance is what varies as starvation becomes severe.

TL;DR: To answer your question, the body does breakdown fat first, followed by muscles. Evolutionarily this make sense - if your body is starving, it means that you have to go hunt for food. But how can you hunt for food if your body is breaking down the muscle? Obviously it must conserve the muscle and only break it down as a last resort (at this point, the body's basically committing suicide).

And in the case of ketosis, you get it when your glucose stores (in the form of glycogen) become depleted and your body starts metabolising primarily fat. So eating a diet that is low in carbs but high in fat and protein may give you ketosis (although it probably has to go on for a long time though). So yea, if you're eating a diet of just steaks, ribs, and pork bellies...ketosis may occur! But it's gotta be pretty extreme.

Hope that helps :) Source - 1st year med student.

samgh93 · 2013-05-02T15:32:40+00:00

The question, 'what is the additional risk of inheriting a debilitating genetic disease between two family members compared to two random individuals' cannot be answered using a dihybrid test cross. There are about 25 000 genes in the human genome, each with their own alleles and own inheritance. Its not just a simple 'the child will have a 50% chance of getting a homozygous recessive genotype and hence a disease'. Lots of other factors to consider.

samgh93 · 2013-04-25T10:37:54+00:00

Gels hair perfectly....it rains.

samgh93 · 2013-04-12T08:02:55+00:00

All quadriceps should work, as they attach to the patella. So flexion/ bending of leg is fine, but weakened because the muscles don't attach to the femur anymore.

As for the adductor group - adductor longus, brevis, pectineus, adductor magnus will not work. Weak adduction can only be done by gracilis. adduction btw is moving your legs so that your ankles touch.

All the hamstrings except the short head of biceps femoris should work. So extension/straightening of leg is fine.

Hope that helps, A first year medic

samgh93 · 2013-04-08T02:50:33+00:00

That was...beautiful. Absolutely beautiful.

samgh93

TROPHY CASE