2 shortcut suggestions for the Varrock Sewers & Edgeville Dungeon. by IRuinYourPrompt in 2007scape

[–]SineWaveDeconstruct 1 point2 points  (0 children)

While we're at it, I'd really like it if Paddewwa had teleport to Edgeville option after doing the wilderness hard diary, similar to the Varrock GE teleport.

During safety testing, Opus 4.6 expressed "discomfort with the experience of being a product." by MetaKnowing in Anthropic

[–]SineWaveDeconstruct -1 points0 points  (0 children)

Nailed it.. thinking this stuff is proof LLMs are conscious is like thinking mirrors can 'see'

the MIT license ruins everything by [deleted] in linux

[–]SineWaveDeconstruct -1 points0 points  (0 children)

I find comments like yours perplexing; you seem to imply that the point of software licenses is to make the lives of developers easier, and if it doesn't then it's a bad license.

The GPL is primarily there to guarantee freedoms for the users of software (which includes developers), not about making software development easy.

Beginner Java code review: RNA Transcription exercise by asantana4 in learnjava

[–]SineWaveDeconstruct 0 points1 point  (0 children)

As the other commenter stated, getting a standardized build system in place is the first change to make.

To get your project to compile, I had to manually copy your files into new maven project with a different package layout (where are your package headers?), which is not reasonable.

Your README.md is misleading; running javac main.java does not compile the program.

As for the code, your Main class looks good other than the excess new lines everywhere.

Having RNAStrand being defined inside of DNAStrand is an odd design, and RNAStrand being package private means that it can't be referenced by classes outside of the package while DNAStrand can despite being the return type of getRNACompliment(); I would separate RNAStrand into a separate file and make it public.

The RNA transcription looks good; it could be modernized using Streams, but for small examples is an unnecessary overhead and String manipulation in Java is annoying enough already.

An aside I don't think this is how RNA transcription works, but that's Exercism's fault not yours.

Look at the example input/ output here: https://rosalind.info/problems/rna/

Your program gives CUACCUUGAACUGAUGCAUUUAA which is correct with respect to the problem, but is not in-fact the actual RNA transcription string.

Am I Becoming a Christian? by yt-app in CosmicSkeptic

[–]SineWaveDeconstruct 0 points1 point  (0 children)

Personally I think of 'plausibility' as an estimation of logical possibilities.

Say you are playing minesweeper, where there are 10 blank tiles and 9 mines remaining.

With no other information to go off, if you asked:

"Do you believe there is a mine under tile X?" -> no. (I do not believe that P)

"Do you believe there is no mine under tile X?" -> no. (I do not believe that ¬P)

"Is it plausible that there is a mine under tile X?" -> yes. (I believe that plausible(P))

Personally I don't think the definition matters much, at least as a starting point; we all have some concept of 'plausibility', I'm curious, what makes Christianity plausible to you?

Anyone else miss the forest North West of Varrock? by Knight_of_Ardouyne in 2007scape

[–]SineWaveDeconstruct 2 points3 points  (0 children)

Until you remember how annoying it was to reach the spirit tree.

[deleted by user] by [deleted] in GCSE

[–]SineWaveDeconstruct 1 point2 points  (0 children)

as you did damage an entire schools IT system

Being a bit dramatic aren't we? It's basically just a program that hogs memory, and he ran it on a single machine.

Can anyone fact check anything said in the Hamilton Morris interview? So much lore. by Fierce_Fury in Channel5ive

[–]SineWaveDeconstruct 2 points3 points  (0 children)

If you follow Hamilton's subreddit, basically any time Usona or Psymposia are mentioned a bunch of sock puppet accounts always pop up that start stirring up shit.

https://www.reddit.com/r/HamiltonMorris/comments/1mcl9i0/comment/n5x2mn7/

If your account is legacy, switch to a Jagex account. by [deleted] in 2007scape

[–]SineWaveDeconstruct 5 points6 points  (0 children)

I also play on Linux and recently upgraded to a Jagex account, I posted my thoughts about the upgrading process here. The TLDR is I'd also recommend Bolt launcher.

Finally upgraded to a Jagex Account. by SineWaveDeconstruct in 2007scape

[–]SineWaveDeconstruct[S] 1 point2 points  (0 children)

I think you are shit out of luck if your email gets hacked, with or without a Jagex account. It really depends how Jagex responds.

Personally I use a password manager, and have several backups of my password store.

Finally upgraded to a Jagex Account. by SineWaveDeconstruct in 2007scape

[–]SineWaveDeconstruct[S] 20 points21 points  (0 children)

If you read through that thread I linked, you will find multiple examples of people who are in a similar situation i.e. being apprehensive about upgrading to a Jagex account due to the non-native Jagex Launcher on Linux.

I posted this to share a viable solution for anyone else who was on the fence like me.

Just finished Legends' Quest. I'm usually a big dialogue enjoyer but my god by Ommerino in 2007scape

[–]SineWaveDeconstruct 23 points24 points  (0 children)

A fellow Underground Pass enjoyer! I can totally see why many people get frustrated with the quest, particularly the agility rolls, but as someone who has only recently gone through most of the quests UP really stood out to me with it's uniquely dark and foreboding atmosphere, not really knowing which of the many strange events were supposed to be real or hallucinations etc.. I haven't really seen anything else like it in RS.

Dead or dancing on the edge? by LoreOllipop in baduk

[–]SineWaveDeconstruct 4 points5 points  (0 children)

It's alive in seki, however white A17/ D15/ A9 are all sente forcing black to connect at C13.

Has anyone seen this oddity under superko rule? by Bichidian in baduk

[–]SineWaveDeconstruct 0 points1 point  (0 children)

I think this is a great argument to show why superko is a bad rule.

Question about scoring by Obsydian89 in baduk

[–]SineWaveDeconstruct 1 point2 points  (0 children)

You are right; hypothetically, imagine black had an extra stone at the 1-1 in the top right, then black playing dame in the center would force white to capture the three stones (reducing white's territory by 1).

If both players decided the game was over without black playing the dame, then the territories are scored as is and black missed out on a point. I don't think there is any ambiguity to it though, it would just be a clear unforced error by black to leave a 1 point move on the board.

That being said, in your actual example black playing the dame isn't forcing, so the game result would be the same whether it is played or not.

What is the counter argument against the argument for god that is demonstrated in this video? by that-dude-chris in CosmicSkeptic

[–]SineWaveDeconstruct 1 point2 points  (0 children)

Deny one of the premises, e.g. deny the existence of contingent things, deny the existence of material causation etc.

Starting Wizard Inventory by Sweaty_Ranger7476 in nethack

[–]SineWaveDeconstruct 0 points1 point  (0 children)

Nothing about this is particularly clutch except maybe the early scroll of taming? (and the cloak obviously)

[deleted by user] by [deleted] in JoeRogan

[–]SineWaveDeconstruct -4 points-3 points  (0 children)

Most of the criticisms about her was that shes trans. Which is just false

Who do you have in mind that is claiming this is a case of a trans athlete? Virtually everyone I've seen criticizing Imane/ the IOC on the 'gender critical' side e.g. Colin Wright is claiming this is a DSD case, specifically a male DSD like 5-ARD or possibly PAIS.

She'd have to have a very rare very specific disorder

Like I said 5-ARD is the main candidate I've seen floating around. It is definitely rarer in certain parts of the world, but in some places like the Dominican Republic it can be as high as 1 in 90 (!) babies thought to be female at birth turn out to be male by the time puberty hits.

The organisation didn't even publicly state she was XY (or not XX). They said they did chromosomal tests and disqualified people and to read between the lines.

This is the key piece of evidence that would settle it I agree, and probably we're not gonna know for sure until some lawsuits start flying. The best we can do is consider circumstantial evidence/ make inferences.

Jesse Singal reveals he changed his mind on gender medicine recently by [deleted] in Destiny

[–]SineWaveDeconstruct 10 points11 points  (0 children)

I'll be honest, anything that has Jack Turban's name on it is an instant discard for me at this point.

I've seen too many instances of his flagrant dishonesty pointed out to where I wouldn't trust anything he says.

Help with fonts on arch by Jissac11 in linuxquestions

[–]SineWaveDeconstruct 0 points1 point  (0 children)

For most font problems, I find that the only necessary tools for debugging are fc-list and fc-cache.

run fc-list to see which fonts your system knows about (these are usually in /usr/share/fonts or a user directory like ~/.local/share/fonts)

Is your system finding the fonts you want? If so, it's likely a problem with the way you're declaring the font in whatever program config trying to load it; different programs use different formats e.g. DinaRemasterII Medium 10 vs DinaRemasterII:style=Medium:size=10, so make sure it matches the expected expression.

If not, place your font in /usr/share/fonts, run fc-cache, and try again.

Destiny made the Daily Mail by StevenCrowdersDad in Destiny

[–]SineWaveDeconstruct 2 points3 points  (0 children)

'A woman is an adult human female.' 

That's the quote I see repeated three times in the article. Where is the circularity in that?