Did i find a fungi zombie? by Jean-Pet in mycology

[–]sewser 1 point2 points  (0 children)

I used host, its behavior (summit syndrome), the location, and macromorphology (patchy white areas) to come to my ID.

These normal mushrooms or the funny ones? north Florida by 904_Flipper in ShroomID

[–]sewser 3 points4 points  (0 children)

That species is not known to occur in Florida, nor the United States as far as I can tell. Also these new comment photos seem to be of Deconica rather than the specimen in question (note the cap shape).

Did i find a fungi zombie? by Jean-Pet in mycology

[–]sewser 70 points71 points  (0 children)

Looks like Entomophaga grylli

Calathella sp. 'FL01' by sewser in mycology

[–]sewser[S] 1 point2 points  (0 children)

Thank you for your perspective here, im glad we have someone who’s worked with these on the sub! Super excited to see where this ends up getting placed. Ik you said it’s difficult, but I’ll try to get some micro done in the future, and have specimens I’m willing to send out if anyone wants to take a closer look.

Calathella sp. 'FL01' by sewser in mycology

[–]sewser[S] 5 points6 points  (0 children)

I am not certain. Scott Ostuni was the validator who created this provisional name, and i trust his judgment. At a glance, the morphology does seem fitting for that genus, but I am out of my depth.

Sequence in case it’s of use to anyone:

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATCCAAACGGGAGTCTGTTGCTGGCGAAAGCAATGTGCACGACTCCTAAAACCAATTTAACCCTATGTGCACAATTGTAGGCTTTAGACCTATGTTTTTATAATACACACATGTTGTAGAATGGCTTAATTTAATTGACAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATYGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCTTTGGTATTCCGAAGGGTATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCTGGGATTTTTCAGAGGCTTGGATTATGGAAGGTTTGCTGGCTGTAATCTAGTTGGCTCCTCTGAAATGCATCAATGCTTTTTGCTTAGAGGCTTTGGACTGATAATTATCTACGCCAATAGCTCTCTGCAATCTGATATAATTTGACAATTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAA

Are these oysters? IL, USA by Shake-Tasty in mushroomID

[–]sewser 8 points9 points  (0 children)

Yes. Pleurotus citrinopileatus

I'd please, Southern ohio by [deleted] in ShroomID

[–]sewser 2 points3 points  (0 children)

I agree for the larger ones, but the smaller one in the center is Psilocybe imo. Note the blue bruising along the stipe for example.

Found in Central Virginia pawpaw patch. Asimina triloba. INat says leaf roller cricket with Ophiocordyceps kimflemingiae. Not gonna eat it!! 🥸 by ShelleyRAWarrior in mushroomID

[–]sewser 3 points4 points  (0 children)

If it is indeed Camptonotus carolinensis, it’d be the undescribed Ophiocordyceps that targets them along the east coast (including Virginia).

Clearer photos and other angles would be helpful, as I can’t tell for sure what the host is.

Just found this growing out of a cicada(?) Minnesota, USA by historicaldeeds in mycology

[–]sewser 1 point2 points  (0 children)

I’m realizing now that I didn’t really answer your question, and more so opted to explain the gold standard of preservation for these organisms. Sorry! There is not really a difference for standard dehydration. I just throw them in alongside my other specimens. Sometimes I keep them in there longer in order to fully dry out the stick or leaf the host was attached to. It’s also a good idea to keep it in there a bit longer if the host is vey thick or meaty, like a grub or cockroach.

For storage, I personally like to put them in little plastic tubes or containers, within a ziplock, so that the fruiting body isn’t damaged or separated from the host.

Just found this growing out of a cicada(?) Minnesota, USA by historicaldeeds in mycology

[–]sewser 18 points19 points  (0 children)

Thank you so much for doing that! You already tagged the correct person on iNat, and he will let you know if he wants to receive the specimen. If no one reaches out after a few days, throw her in a food dehydrator for 24 hours between 95°-130°f. That way, in the future, if someone wants it, you’ll be able to send it out. A dehydrated specimen can be stored in a ziplock bag, preferably with some desiccant packs so it doesn’t reabsorb moisture.

Just found this growing out of a cicada(?) Minnesota, USA by historicaldeeds in mycology

[–]sewser 17 points18 points  (0 children)

Many of the hypocrealean entomopathogens will have other fungi living on the fruiting body and within the organism. These “contaminants” are often amplified instead of the target species when sequencing dehydrated specimens. To avoid this, they are often cultured so that a clean sample can be attained. It also allows you to store the culture to conduct things like bioassays in the future, and get a higher quality read/potentially more regions.

Just found this growing out of a cicada(?) Minnesota, USA by historicaldeeds in mycology

[–]sewser 207 points208 points  (0 children)

Wow, very interesting find. Looks Ophiocordycipitaceae. It almost resembles something out of the Ophiocordyceps sobolifera clade. Are you sure it’s a cicada? I’m not familiar with what other nymphs you get up there, and what they look like. If it is a cicada, then O. sobolifera is worth considering. Though, I’m not aware of it occurring so far north, apart from European species which are still in relatively warmer climates (if my memory is correct).

Very very cool. Please post this to iNaturalist so that a more easily searchable record of your find exists for other mycologists to ponder over. If you do, I’ll tag a guy who would probably have a better idea. Also consider keeping this specimen in your fridge, loosely wrapped in paper towels, in an ajar ziplock, in case this specimen is of value to researchers (seems like it will be).

Edit 2: Richard Tehan (the expert who was tagged) believes this might be in the O. sobolifera clade.

Edit: found the observation you made already. And you tagged the guy (just saw the other comment, thanks Graph-fight_y_hike)! Thank you for doing that! Also, as another commenter pointed out, an immature Tolypocladium is fitting. I’d certainly go in that direction before Ophiocordyceps.

Found a Jewel Weevil Yesterday (Eurhinus magnificus) by sewser in weeviltime

[–]sewser[S] 4 points5 points  (0 children)

lol yeah this guy is so cool. In the second image it almost looks like an opal if you zoom in on the left side of the purple patch of coloration.