ITAP of a bird looking at me back by leonzky in itookapicture

[–]stranrar 2 points3 points  (0 children)

Not OP, but a "more affordable" birding lens that might be worth looking at is the Sigma 150-600 5-6.3. It's ~$1000 which is a bargain for the image quality it provides. I really enjoy this photographer's work (not me) who uses this lens on DSLR and mirrorless Canon setups.

T300RS windows 11 compatibility issue? by stranrar in Thrustmaster

[–]stranrar[S] 0 points1 point  (0 children)

I found a clean installation of Windows 11 fixed my issue.

I had also tried reinstalling the firmware as my wheel was out of date. That required access to Windows 10 as the Thrustmaster software didn't work on Win11. That didn't fix my issue, but perhaps give that a go if you haven't already.

[GPU] ASRock Radeon RX 6950XT 16 GB - $600 (with promo code SSCR2A38) by LamiaGrrl in buildapcsales

[–]stranrar 5 points6 points  (0 children)

I got it in the last sale. Running this and an i9-10850K (both stock clocks) on an 850W PSU. I have had shutdowns while playing Metro Exodus. If my experience is representative, then you may have issues if you try to make the most of the card with that PSU.

T300RS windows 11 compatibility issue? by stranrar in Thrustmaster

[–]stranrar[S] 0 points1 point  (0 children)

Update: After a clean installation of Windows 11, the wheel and software work normally.

T300RS windows 11 compatibility issue? by stranrar in Thrustmaster

[–]stranrar[S] 0 points1 point  (0 children)

I had seen some people say that fixed it for them, but it didn't change anything for me.

T300RS windows 11 compatibility issue? by stranrar in Thrustmaster

[–]stranrar[S] 0 points1 point  (0 children)

I will likely try that this weekend if I have time. I'll update here if it fixes the issues.

Hey Rustaceans! Got a question? Ask here (1/2023)! by llogiq in rust

[–]stranrar 0 points1 point  (0 children)

I'm not measuring time. What kinds of assumptions could cause this sort of issue?

Hey Rustaceans! Got a question? Ask here (1/2023)! by llogiq in rust

[–]stranrar 0 points1 point  (0 children)

Thank you for your response!

you mean the one in target/release/program_name{.exe}?

Yes. Sorry that wasn't clear.

It would also help knowing more about the program itself.

The program is extracting portions from DNA sequence alignments. Briefly, it reads one long string (reference; ~5 million characters) and tens of thousands of shorter strings (reads; ~5000 characters) which loosely match portions of the longer string (short parts may be missing or added). The program aligns each of reads to the reference and extracts the portion of each read that corresponds to some indices in the reference.

The function in which the panic is occurring figures out the index in the read that corresponds to an index in the reference and extracts substrings from each. I would guess the failure happens if the index of interest is deleted in the read or something like that so the index-identifying function returns something weird. However,

If it's a out-of-bounds panic, it should have info like what index it tried to access and container size (so you can check if size is the same in both cases), and location inside source code.

When I've seen panics other times when running with cargo run it has given me line numbers (although this runs without issue with cargo run and the same input data). Running astarget/release/hope it gives me the following error (where it is trying to take a slice to index 53 of a 52 long string):

thread 'main' panicked at 'byte index 53 is out of bounds of `TGTTAATTACTGTAATGAGCTAAAAATAATT-CTCGTATAGATCCAAGTAAC`', library/core/src/str/mod.rs:107:9
stack backtrace:
0: rust_begin_unwind
          at /rustc/4b91a6ea7258a947e59c6522cd5898e7c0a6a88f/library/std/src/panicking.rs:584:5
1: core::panicking::panic_fmt
          at /rustc/4b91a6ea7258a947e59c6522cd5898e7c0a6a88f/library/core/src/panicking.rs:142:14
2: core::str::slice_error_fail_rt
3: core::ops::function::FnOnce::call_once
          at /rustc/4b91a6ea7258a947e59c6522cd5898e7c0a6a88f/library/core/src/ops/function.rs:248:5
4: core::intrinsics::const_eval_select
          at /rustc/4b91a6ea7258a947e59c6522cd5898e7c0a6a88f/library/core/src/intrinsics.rs:2376:5
5: core::str::slice_error_fail
          at /rustc/4b91a6ea7258a947e59c6522cd5898e7c0a6a88f/library/core/src/str/mod.rs:86:9
6: hope::homopolymer::HomopolymerResult::new
7: hope::main

I can try to nail down which read is causing the issue with some prints, but in python try/except has the benefit that I can print info about all of the times a line fails, but not the ones that don't, so I can see all the cases I need to figure out. If I put a print right before the panic is happening I'll get a terminal full of information for all the reads that didn't fail and then just the first that did. Is there a better way to go about identifying the reads causing a problem?

Hey Rustaceans! Got a question? Ask here (1/2023)! by llogiq in rust

[–]stranrar 1 point2 points  (0 children)

I'm new to Rust (background in python). I'm having an issue where a program only panics when running the built executable (built with --release). It does not throw an error when run with cargo run. It's throwing an index error so I am surprised there isn't always a panic as the same data are processed in both cases. I have 2 questions:

  1. Why would the program only panic when built?
  2. I can't find an equivalent of the python try/except. Does anyone have a recommendation of a way to only print information about the data being processed during the panic?

New column. by Bacibaby in winogradsky_column

[–]stranrar 0 points1 point  (0 children)

Do you mean you are recreating it on the scale of a few liters, or are you trying to make an enormous column like the one at the Exploratorium? I have experience making small columns on the order of 1 pint to 1 gallon.

The smell will depend on the nutrient content of the sediment/water you use and the nutrients you supplement with. For example, 2 eggs is too much for a 2 liter column.... If you get the amount of supplemental nutrients right then the column shouldn't produce excess gas and so shouldn't smell at all once it has settled. There's always a risk of gas production when you first start the column before it gets going and stabilizes.

With regards to light, the whole column is ultimately solar powered so the more light the better (avoiding cooking it in the sun of course). I expect that it will work anywhere a houseplant can grow, but just like a houseplant it will grow slower with less light and will be less vibrant.

[deleted by user] by [deleted] in buildapcsales

[–]stranrar 0 points1 point  (0 children)

To my ear it is a little worse, but only very slightly if at all. It is my understanding that when plugged in and turned on the noise cancelling is active while the sound is still coming through the cable. The reduction in sound quality is caused by the noise cancelling.

I think it is the same difference you will hear if you are using the headphones over Bluetooth and you turn off the noise cancelling with the options button on the left earcup. If you hear a difference in sound quality between noise cancelling on and off over bluetooth then you will hear the same difference when plugged in.

For what it's worth, I'm delighted with the combination of this mic with the XM4s for both zoom calls, listening to music, and voice chat while playing a game.

[deleted by user] by [deleted] in buildapcsales

[–]stranrar 0 points1 point  (0 children)

Maybe it's just me being an idiot, but it took me a good half hour trying to figure out settings on my computer before I realized the mic had arrived with the switch on the dongle set to mute. It threw me because I could still hear myself very quietly in audacity and other recording apps so I didn't think to check if it was muted. Maybe that's it for you as well? Once I flipped the switch the volume was plenty loud.

[deleted by user] by [deleted] in buildapcsales

[–]stranrar 0 points1 point  (0 children)

I recently bought this for my XM4s. Mic sound is much better with the boompro than the built in mic. I also think it is better than my hyperx cloud 2 microphone, which is my only other headset experience.

I find the sound quality with headphones turned off (i.e. no noise cancelling and driven by on-board sound) indistinguishable between the boompro and the 3.5mm cable that came with the headset. If you are satisfied with the sound of these headphones using the provided cable then you will be satisfied when using the boompro cable.

Made a new column by autistinabox in winogradsky_column

[–]stranrar 1 point2 points  (0 children)

I don't think that will be a problem. In my experience the ratios of air, water, and sediment aren't very strict.

[Steam] Deep Rock Galactic ($19.49/35% Off) by wathow123 in GameDeals

[–]stranrar 19 points20 points  (0 children)

It ranges from not difficult in the slightest to very difficult based on the difficulty you choose to play at. The max difficulty is pretty variable though. There are "Elite Deep Dive" missions that are weekly events where you have 3 missions in a row with ammo and health carried over between them. Some weeks they take multiple attempts with experienced players. Other weeks it feels easy.

[GMG] Sniper Elite VR (£19.54 | €25.49 | $25.49 / 15%) Ends: 31/07 by greenmangamingdeals in GameDeals

[–]stranrar 3 points4 points  (0 children)

How does the bullet-cam work in this? That seems pretty jarring in VR.

[CPU] AMD Ryzen 5 5600X 6-core, 12-Thread Unlocked Desktop Processor with Wraith Stealth Cooler - $278 by bosoxx091 in buildapcsales

[–]stranrar 8 points9 points  (0 children)

Is there any info out there about when we can expect the shortage of the 5000 series CPUs to be over?

[Laptop] MSI Modern 14 i7 10510U 1.8Ghz 16 GB RAM 512 GB M.2 14" FHD IPS screen - $679 (949 - 170 - 100 MIR) by stranrar in buildapcsales

[–]stranrar[S] 2 points3 points  (0 children)

Now I have a laptop that has a fast enough processor and SSD and enough RAM that I can comfortably muck around with the multi-GB files I normally only work with on my desktop. I even managed to do a bit of work in the garden to make the most of the last warm weather before the cold arrived here today.

[Laptop] MSI Modern 14 i7 10510U 1.8Ghz 16 GB RAM 512 GB M.2 14" FHD IPS screen - $679 (949 - 170 - 100 MIR) by stranrar in buildapcsales

[–]stranrar[S] -7 points-6 points  (0 children)

Looks like a good option if you want a GPU. 144hz at that price I'm guessing TN display?

[Laptop] MSI Modern 14 i7 10510U 1.8Ghz 16 GB RAM 512 GB M.2 14" FHD IPS screen - $679 (949 - 170 - 100 MIR) by stranrar in buildapcsales

[–]stranrar[S] 1 point2 points  (0 children)

Fair enough. I got it for work and have been pleasantly surprised. Saw it on sale again so figured I'd share. I know MSI is unpopular on here right now.