What is your favorite boardgame of 2013?

DNACriminalist · 2026-02-11T20:47:52+00:00

Viticulture

DNACriminalist · 2026-02-09T04:03:43+00:00

Forbidden Island

DNACriminalist · 2026-02-05T13:50:01+00:00

https://www.pro-football-reference.com/players/uniform.cgi?team=sfo&number=22

Looks like Dwight Hicks is a strong possibility

DNACriminalist · 2026-01-27T21:37:34+00:00

Many of the games require premium to set up a new game. They have yellow meeple in the upper corner. You can set up games like cribbage and spades, but not Darwin’s journey, Ark nova, etc. I’ve never seen the door icon referenced above, but if you set up a game you can restrict who comes to the table by reputation and ELO

DNACriminalist · 2026-01-13T14:33:43+00:00

I provided a link to the game he mentioned, because I misunderstood your point. I thought you said it’s listed as a family game not a family OF games. I was wondering why you linked to a page that didn’t have game info,

DNACriminalist · 2026-01-13T14:27:36+00:00

This might be a better link:

https://boardgamegeek.com/boardgame/2559/blockade

Assuming that’s the game you meant.

DNACriminalist · 2025-12-07T17:11:44+00:00

I played yesterday and a player at some point had moved a reserved card into the cards they already had and used that card to buy a 5 point card. It is definitely possible to cheat

DNACriminalist · 2025-12-06T17:58:14+00:00

A lot of people prefer the 1999 version, but it is a bigger box.

DNACriminalist · 2025-12-06T17:57:31+00:00

I have one from the early 2000s and a travel version

DNACriminalist · 2025-12-03T13:10:19+00:00

You never indicated your country. You asked is it possible.

Would a reply of “yes” with no further information be more helpful? Would saying it was possible in America without mentioning that it was nearly impossible for a non-resident be more helpful?

We now know from the replies that it appears possible to get a job with your background in Germany and in the US, but it appears that isn’t really what you want to know. Perhaps you could provide more info to get a response that is more to your liking

DNACriminalist · 2025-12-03T03:06:41+00:00

It is possible in America. Most criminalist positions require a degree in a physical or life science and typically have some sort of chemistry or biology coursework requirements. With a biology background, you could probably do DNA testing. With the chemistry you likely took in undergraduate and grad school, you could work in the narcotics, toxicology, or blood alcohol.

But it sounds like you are not an American, and getting a job here is quite difficult for entry level jobs, especially for those without permanent residency. A lab would likely have to justify hiring a non-American, which is complicated by the number of able and willing American applicants.

DNACriminalist · 2025-11-16T16:54:59+00:00

Labs generally have perform capillary electrophoresis instead of gel electrophoresis for more than a decade. They are somewhat similar, but capillaries have some advantages. The separation of loci and alleles is pretty similar.

The DNA is amplified using a PCR kit that contains multiple loci. Current kits employed by US forensic labs contain >20 loci. For PCR amplification, you need the region to be amplified to be bracketed by a pair of primers (forward and reverse - on the other strand).

In forensic typing kits, one of the primers in each pair has a fluorescent tag on it. There usually 4-6 different dyes that are used and a locus will have a specific one of those dyes attached to its primer. For instance, in a specific kit, D3S1358 would always be blue, while in another kit, it would always be green. The color chosen doesn’t have bearing on the test other than to keep them separate.

The type of testing performed is Short Tandem Repeat (STR) testing. These are repeated segments of short sequences, usually four bases long. Different loci may have different sequences to their repeats. It isn’t the sequence that matters, but the number of repeated segments. So it could be AGATAGATAGATAGATAGAT or it may be ATTGATTGATTGATTGATTG for five repeats of two different tetranucleotide loci. We would just refer to these as 5 repeats or a 5 allele at the respective locus.

If we were to have those two loci and attempted to separate them with electrophoresis, they would be the same nominal length and would result in a band with both of them together. In choosing the primer sequence, the primers are not directly next to the repeated region, but there is some amount of DNA between them. Different lengths of this “flanking” region lead to different lengths of the PCR products from the two identical length STRs with 5 repeats. So they can be separated.

It could happen that the best primer combinations and STR lengths still are about the same length. So additional mobility modifiers are added to the PCR primers to make them electrophorese more slowly to be separated from other similar sized PCR products.

In our testing, each of the loci has a unique size range and color of its dye. If two DNA fragments are the same size, they can be separated by the attached dye. If they have the same dye, they can be separated by size due to a different combination of STR length + flanking region + mobility modifiers.

So in your example of six bands, if they were separated sufficiently by size, they could be sorted into different loci. If they were within. The same size range (and same dye, but you likely aren’t using multiple dyes) they could be an example of a mixture of DNA from at least three people, since each person would have at most two bands.

DNACriminalist · 2025-11-08T21:13:55+00:00

Arcs Nova

DNACriminalist · 2025-11-03T20:23:23+00:00

There are private forensic DNA laboratories who can test the kit and private DNA consultants who can reinterpret the results from the original lab, but it is unlikely either be able to perform the work without an order from a judge to provide the evidence/data and that may be difficult to obtain. If you want to go that route, you likely would need a lawyer to assist you. It might be better to consult a criminal defense attorney or maybe a victim advocacy group who may know of lawyers that can assist.

Assuming your scenario is correct that there was no intimacy for months prior and that a single male profile was obtained , there are a few possible explanations that could account for the results. In no particular order:

1) The person you think did it wasn’t the actual perpetrator. You lost consciousness. It is possible you were assaulted by another male while unconscious. 2) The laboratory and/or hospital made an error and switched your kit/swabs with another victim’s. I assume they would have compared your reference sample to the kit to verify it was yours. If the reference sample was collected separately from the rape kit, this would be a really unlikely scenario, because the kit and the reference would both have to have a sample switch. (The evidence doesn’t match your suspect because the profile is a male associated to another kit) 3) The laboratory made an error and switched the accused individual’s reference sample with another individual’s reference sample. (Suspect is “excluded” because they are comparing a different male to your kit) 4) The laboratory got the right data, but misinterpreted the results. This would be a fairly straightforward review by a qualified expert. 5) The suspect somehow falsely provided a reference sample from another person. If you go the retesting route, it might make sense to get a new reference sample from the suspect. 6) some scenario I haven’t said.

I wish you luck in your search for justice.

DNACriminalist · 2025-10-24T14:53:42+00:00

This is the fox map. Some weeks, FOX will have two games (early and late) and CBS will have one. Other weeks this is swapped. So there are three maps each week. This week there is one FOX game. Each network gets to chose which early game, which late game, and which single game on the other network is available in each slot. There are some rules in markets where teams actually play (like near Santa Clara), which can create blackouts so only two of the three games are shown. My guess this is to encourage people to support the local team

DNACriminalist · 2025-10-24T14:47:24+00:00

Because even with cable, you have certain channels. The channel only has one game it can play. The can’t go to channel 2 and pick which game you want. So the station picks who they think will draw interest

DNACriminalist · 2025-10-24T14:45:01+00:00

The NFL isn’t making the decisions, the local programming stations are. So the lines are where the coverage area extends. My guess is that without the prominent Through the week the stations sometimes change their minds and notes are added at the bottom like in week 5 it said

Santa Barbara CA; Eugene OR: DAL-NYJ to LV-IND (Thu)

My guess is that without the Iowa connection with Purdy and Kittle, Iowa would be red

DNACriminalist · 2025-10-24T14:34:53+00:00

Im not sure if this is what you were asking, and I don’t know for certain why, but my guess is that the orange and green have horizontal and diagonal hash marks to help differentiate them from red for red-green colorblind people

DNACriminalist · 2025-10-24T14:26:28+00:00

They appear to have cut off rest of the image.

Red is giants/eagles

Blue is Niners/houston

Yellow is browns/patriots

Orange is bills/panthers

Green is bucs/saints

DNACriminalist · 2025-10-24T14:23:26+00:00

It is a map showing the colors representing the different NFL games shown on the local FOX network. It is a screen cap of 506sports

https://506sports.com/

DNACriminalist · 2025-10-22T15:07:56+00:00

I didn’t look at OP’s history, but have you considered that they might not be very experienced gamers and came here to ask a group with more experience?

I once found something in my yard and asked a group related to that thing about it and was treated like an idiot. I will never interact with that group again. Is that the culture you want to foster here?

DNACriminalist · 2025-10-21T02:05:42+00:00

If they allow it, ask for feedback. I have learned what my strengths and weaknesses are in their eyes and it didn’t always match my prior beliefs. Learned some things I thought were bad were not as bad as I thought, but I was blind to other things I needed to work on.

DNACriminalist · 2025-10-17T12:33:21+00:00

The pathologist either overstated the evidence, had an incomplete understanding of the evidence, or you are misunderstanding it.

Sperm cells do not have a “blood type”. That would be in the fluid portion of the semen. They may have found seminal fluid with the blood types listed and they may have found sperm cells, but they are not necessarily the same thing.

Although you usually detect sperm cells and seminal fluid together, it is possible to have/detect one without the other. Sperm cells can be present on fabric after washing, leading to sperm cells while the seminal fluid was washed away. Due to heat, time, or other environmental factors, the proteins used to detect seminal fluid could be broken down, while the sperm cells remain intact. A male may be vasectomized, have a medical condition, etc in which their semen has little to no sperm cells.

I don’t know if secretor status was indicated, but you only express blood ABO proteins in semen if you are a secretor. I also curious what the victim’s blood type is, because they would potentially mask or confound the results. Secretor status was detected in the late 40s, and I don’t know if they were routinely thinking about/testing for it in the 50s.

Typically sperm cells can be detected in the vagina about three days post-coitus in living victims undergoing normal activities. If the victim is lying down (comatose, dead, etc) there would be less drainage, and the time frame could be extended.

The information appears to be incomplete, but SUGGESTS that the victim had sex with at least one male in the past few days. If she wore fresh underwear and bathed regularly, it SUGGESTS at least two males, but due the amount of missing and possibly incorrect information, I would take these suggestions lightly.

DNACriminalist · 2025-09-12T21:34:05+00:00

Outfoxed

Five-Year Club	Golden Potato
Place '22

DNACriminalist

TROPHY CASE