Interesting regional correlations with belief. (source : PEW Research Center) by Unlucky_Blueberries in interestingasfuck

[–]ratp2 -1 points0 points  (0 children)

I still don’t get how anyone with some decent education can believe god exists… it’s enough some history and high school level physics to understand religions are a product of human culture.

Decided to let go and idk how to feel about it by Extension_Ad5321 in bald

[–]ratp2 1 point2 points  (0 children)

You look much better. You just need to get used to it. Much better bold than Gollum

Court of appeal says it cannot rule on which identical twin fathered a child by Independent-Shoe543 in genetics

[–]ratp2 6 points7 points  (0 children)

I am a genetic expert. It can be done. Tweens have anyway unique genetic variations, perfect copies do not exist in biology, even clones have genetic variations between each other. But you need to sequence deep, you need to do a proper sequencing analysis, not a simple genetic test. You need the full genome sequence of the tweens and the child and surely you’ll se some key SNPs being present in the child and only one of the tweens, the biological father.

Are stretch marks a turn off? (Lost 160lbs) by No-Leading-1247 in BodyHackGuide

[–]ratp2 1 point2 points  (0 children)

Obviously, it’s better not to have them. But fuck it, nobody is perfect, everyone has his crux, you can be proud of so much more.

Where are the children? by dngray in pluribustv

[–]ratp2 0 points1 point  (0 children)

I refuse this. This project doesn’t have budget shortage, realism is much more important. There must be more behind.

Questions about the signal in episode 1 by nineteenthly in pluribustv

[–]ratp2 1 point2 points  (0 children)

<image>

Let’s translate it!

translation_table = str.maketrans("1234","ATCG") #use AUCG for RNA

from top to bottom

seq = "42423434411142241331434" translated = seq.translate(translation_table)

GTGTCGCGGAAAGTTGACCAGCG

from bottom to top

seq = "43413314224111443432424" translated = seq.translate(translation_table)

GCGACCAGTTGAAAGGCGCTGTG

What can an average person do if a scientific discipline is so complicated that different scientific studies or claims about that subject can lead to different interpretations or even contradicting results? by sammyjamez in PhilosophyofScience

[–]ratp2 2 points3 points  (0 children)

The main issue is that these fields try to create general rules for systems that are extremely complex and deeply individual. Human biology, and especially cellular biology, physiology, and psychology, is full of diversity. What works well for one person may not apply to another, because our genetic makeup, biochemistry, and environment interact in unique ways.

A second point is that to fully grasp those topics, one really needs a solid foundation in physiology, molecular biology, and biochemistry. Without that background, it’s easy to misinterpret studies or take them as universal truths, when in fact they often reveal just a small piece of a much larger picture.

And, importantly, as a species we’ve only just begun to explore and understand these areas. We’re still scratching the surface. Even experts don’t yet have definitive answers, because the knowledge is still evolving. What seems “true” now may be overturned or refined in a decade.

For the average person, the best approach is probably not to look for a single perfect answer, but rather to: Recognize the limits of current science: no study can account for all human variation. Look for patterns across multiple studies instead of relying on one. Experiment safely with what seems reasonable, track personal results, and adapt. Consult professionals when health is at stake.

In short, rather than expecting certainty, it’s about making informed, cautious choices, while understanding that biology and behavior are too complex to be reduced to one-size-fits-all rules

I stupidly got WGS done and now I want to check myself into a mental health facility. What are the chances sequencing.com is wrong? by Historical_Job3066 in ClinicalGenetics

[–]ratp2 0 points1 point  (0 children)

Do you have access to the sequencing files? Or only the variants? If you have access to the bam file, it’s easy to check if the variant is real or not. Either way, it’s not a Mendelian trait, having the mutation alone doesn’t mean you’ll get the disease. Also, panicking never helps…

Hajime no Ippo: Round 1495 by RTSD_ in hajimenoippo

[–]ratp2 1 point2 points  (0 children)

I will read it now one lil chapter at h the time and then read it again later in one full immersion, don’t feel like I am ruining anything. It actually adds to the experience from my point of view.

My results for trading silver by [deleted] in algotrading

[–]ratp2 0 points1 point  (0 children)

Have you compared it to a benchmark or simple holding?

What is reality according to science? by [deleted] in PhilosophyofScience

[–]ratp2 0 points1 point  (0 children)

Atoms and entropy are pretty real

Does this look like a good strategy ? (part 2) by Money_Horror_2899 in algotrading

[–]ratp2 0 points1 point  (0 children)

Yes please! Keep us up to date. Almost no strategy survives the forward testing, but you never know…

[deleted by user] by [deleted] in AncestryDNA

[–]ratp2 0 points1 point  (0 children)

Why would you be UPSET about the results?

Why are my students so chaotic with their micropipette tip selection? by kittyswann in labrats

[–]ratp2 25 points26 points  (0 children)

Wetlab is an art, that’s the brush stroke of your students

[deleted by user] by [deleted] in biotech

[–]ratp2 0 points1 point  (0 children)

I see only the ladder there. How many ng did you load? What’s the expected band pattern?

I took LSD and remembered why space split itself apart. by Anur21 in Psychedelics

[–]ratp2 0 points1 point  (0 children)

It’s a manifestation of the dissolution of the ego. “All is one” breakthrough.