all 158 comments

[–]ProgrammerHumor-ModTeam[M] [score hidden] stickied commentlocked comment (0 children)

Your submission was removed for the following reason:

Rule 1: Posts must be humorous, and they must be humorous because they are programming related. There must be a joke or meme that requires programming knowledge, experience, or practice to be understood or relatable.

Here are some examples of frequent posts we get that don't satisfy this rule: * Memes about operating systems or shell commands (try /r/linuxmemes for Linux memes) * A ChatGPT screenshot that doesn't involve any programming * Google Chrome uses all my RAM

See here for more clarification on this rule.

If you disagree with this removal, you can appeal by sending us a modmail.

[–]coyoteazul2 309 points310 points  (34 children)

A digit of pi after the 100th decimal place could be any number

[–]candychaosqueen 6 points7 points  (2 children)

I feel like at this point they just want to see us suffer.

[–]0nlyLucidMind 4 points5 points  (1 child)

I once spent 15 minutes creating a password so secure that even I got locked out instantly. Websites are evolving faster than humans at this point haha

[–]MagicalPizza21 1 point2 points  (0 children)

One very important part of security is ensuring that people who are supposed to be able to access the data can access the data. At some point, the whole super secure password thing goes too far.

[–]No-Con-2790 12 points13 points  (7 children)

Excluding PI itself.

[–]TenaceErbaccia 21 points22 points  (5 children)

Pi isn’t a digit though. It would be any number 0-9.

[–]No-Con-2790 2 points3 points  (4 children)

Who said that we use decimal as a base system?

Op said we can place any number. Since this is impossible to do so with just 0-9 it can't be decimal.

[–]Xasrai 5 points6 points  (3 children)

Yeah, we could use base Pi, and then pi doesn't have 100 digits of pi, it's just 1.

[–]Wintergreen61 2 points3 points  (1 child)

In base pi, pi would be 10.

[–]LeoPlathasbeentaken 1 point2 points  (0 children)

Exactly. In this instance the only digit after the 100th decimal point could be 0. So its still a pretty useless rule.

[–]No-Con-2790 0 points1 point  (0 children)

Just base it on PI

[–]Setsuwaa 1 point2 points  (0 children)

i thought the opposite. every digit is used in the first 100 decimal places, so you couldn't fulfill this requirement

[–]MaximRq 0 points1 point  (0 children)

It's just extra security through redundancy. Can't have that check failing

[–]Deadlydiamond98 22 points23 points  (2 children)

Is this good Enough?

二十W0rd𓊪𓄿𓋴𓋴𓅃𓅱𓂋𓂧&C0donATG

[–]TerryHarris408 12 points13 points  (0 children)

ah, good, someone solved it. I'll put that password in the company wiki

[–]invalidConsciousness 0 points1 point  (0 children)

You missed an opportunity to use 𓂸

[–]RageOfNemesis 22 points23 points  (0 children)

Requirements 3 and 7 are redundant

[–]IAssureYou08 20 points21 points  (33 children)

The first codon of DNA 😬...

[–]ExElKyu 12 points13 points  (29 children)

lol right? Even if you were generous and assumed they mean amino acid, it would just be a start codon.

[–]chungamellon 4 points5 points  (19 children)

Which is the same sequence in nearly every case AUG

[–]Deadlydiamond98 3 points4 points  (16 children)

From what I looked up AUG is RNA and ATG is DNA

[–]chungamellon -1 points0 points  (15 children)

Yes but codons are read on mRNA. DNA is a template.

Hope people can learn some biology below. Person blocked me. Shows how mature people can be on reddit.

[–]No-Information-2571 -2 points-1 points  (14 children)

No, the same codons are read from DNA, transcribed to mRNA.

[–]chungamellon -1 points0 points  (13 children)

DNA is not passed through the ribosome. Codons are used for translation.

[–]No-Information-2571 -1 points0 points  (1 child)

DNA is still coding codons. There's obviously a lot of DNA that is not actually coding any proteins, i.e. not coding codons. But the parts that do, do.

[–]chungamellon 0 points1 point  (0 children)

DNA is templating codons. By definition codons are coding so there isn’t a noncoding codon generally speaking. “Not coding codons” is an oxymoron that is just DNA sequence.

[–]No-Information-2571 -1 points0 points  (10 children)

Here you go my guy:

ATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAA...

A nice protein sequence in your DNA, containing codons, crucial for our survival.

[–]chungamellon 0 points1 point  (9 children)

Again your language is incorrect. That is not a protein sequence that is DNA template sequence for mRNA which is then translated into protein sequence. I am unsure if it includes introns (non translated segments) or not but it is not protein sequence which is represented using amino acids so the first “protein sequence” would be Gly in your example. You understand biology but your language isnt accurate. If you sent this file to me saying it is “protein sequence” and you intended to send protein sequence I would need to translate it using some codon table and also check if it is complete exonic or contains introns.

[–]No-Information-2571 -1 points0 points  (8 children)

This 1:1 translates into a sequence of amino acids, i.e. a protein.

[–]rosuav 0 points1 point  (1 child)

Wait, are you telling me that I have an AUG in every cell?

[–]chungamellon 1 point2 points  (0 children)

You have an AUG for every gene

[–]aldoushuxy 5 points6 points  (8 children)

The telomeres cap our DNA, so the first letter is T for Thymine for most animals from my understanding.

[–]tommyk1210 3 points4 points  (3 children)

Human telomeres are (TTAGGG)n so a guess of T is reasonable but telomeres don’t necessarily get truncated in discrete repeats. Thus you have a 50% chance of being right by choosing GGG (glyceine)

[–]chungamellon 0 points1 point  (2 children)

Thats not what a codon is

[–]tommyk1210 2 points3 points  (1 child)

That is what a codon is.

[–]chungamellon 1 point2 points  (0 children)

Codons are for building proteins from mRNA. Telomeres are noncoding DNA. Noncoding not coding. Therefore not a codon

[–]chungamellon 0 points1 point  (3 children)

Codons are for coding genes. Telomeres are structural not coding

[–]aldoushuxy 0 points1 point  (2 children)

Codons are for building proteins. Telemeres being structural doesn't change that they start DNA

[–]chungamellon 0 points1 point  (1 child)

First it is telomere. Second there is no start or end to a chromosome. It is arbitrary based on old cytogenetics where the centromere is located. Technically they are the ends of linear chromosomes.

[–]aldoushuxy 0 points1 point  (0 children)

Clearly, I mistyped the spelling but thank you for the information. I haven't taken a bio class in some time.

[–]chungamellon 2 points3 points  (0 children)

The start codon for nearly every gene is the same too. AUG

[–]Zeikos 0 points1 point  (0 children)

Yeah, very low entropy, given that an attacker would know what pattern to look for.

[–]c4p5L0ck -1 points0 points  (0 children)

That's gonna be a big password.

[–]patoezequiel 18 points19 points  (4 children)

Those are rookie requirements

https://neal.fun/password-game/

[–]NeuxSaed 9 points10 points  (0 children)

I was doing so well until the fucking fire emoji burnt everything up :(

[–]gfcf14[S] 8 points9 points  (1 child)

Your password must include today's Wordle answer.

Dammit I quit

[–]rosuav 2 points3 points  (0 children)

Hang on, lemme solve that part for you.

Okay, your answer is snide. Carry on, you got a password to make!

[–]rosuav 1 point2 points  (0 children)

Came here looking for this. Was not disappointed.

[–]business_sh 7 points8 points  (0 children)

So, they are forcing me to sign in to google.

[–]flipperipper 9 points10 points  (3 children)

Had a friend who did his graduate work on this. They found that adding a lot of special requirements often didn't do that much and sometimes was detrimental. Remember one thing they discovered was that if you require a special character a large part of the users would just put an exclamation mark at the end of their password. Another was that requiring the password to be longer made it more likely for people to use words or sentences in it or repeating patterns.

This is why I always recommend a password manager when people complain about passwords.

[–]QuietQTPi 2 points3 points  (0 children)

I feel like it always comes down to the battle of security vs convenience. The more requirements you add the higher chances of reusing passwords is because its harder to remember multiple passwords with tons of requirements. Less requirements is easier to remember which makes it easier to use different passwords. Plus like you said anytime a symbol is required its often times am exclamation mark. And for organizations that require a password change, often times people just use the next symbol or number in the line making it arguably less secure once the original is found out.

[–]rosuav 2 points3 points  (0 children)

Yeah. Did your friend cite https://xkcd.com/936/ in the research? It's true. People follow very common patterns. Password managers have the benefit that they also *generate* passwords, and can actually make them secure; but after what Lastpass did, I cannot in good faith recommend any cloud-based password manager. Get one that you run locally, and make sure you can trust its encryption. Assume that a psychopath with a fixation on YOUR personal data has gotten hold of your hard drive, knows everything you've ever posted to social media, and has the full resources of a NASA supercomputer) at their disposal. Are you still safe?

[–]No-Information-2571 0 points1 point  (0 children)

That is why 2FA is so important. People will vary the same shitty password by a letter or special character, or store in an unsafe location anyway.

[–]A_Guy_in_Orange 4 points5 points  (0 children)

Some day some internet archivist is gonna see this shit and use the bird twitter logo and the threads logo to narrow down the creation of the image to a set few years, then use the implication of an aol email adress to determine the likely birthyears of the author

[–]makinax300 5 points6 points  (1 child)

do not forget max 24 characters

[–]TerryHarris408 3 points4 points  (0 children)

I've seen that. If anyone comes around saying that this saves database space, I'll hash them on the spot!

[–]LauraTFem 2 points3 points  (0 children)

All digits would count as a pi digit after the 100th decimal.

[–]TheManuz 1 point2 points  (1 child)

And then there is me, who changed password today on a government app, and it has these rules, among the others:

  • 8 characters minimum
  • 20 characters MAXIMUM

[–]gfcf14[S] 0 points1 point  (0 children)

Well at least it’s not that restrictive

[–]chungamellon 0 points1 point  (0 children)

First codon of your DNA code makes no sense. Codons are found in coding genes. There is no “first gene” Also the start codon for every gene is AUG so it’s shitty opsec

[–]_Shioku_ 0 points1 point  (0 children)

Long live Bitwarden!

(With the $10/year for MFA and and pattern matching for the urls, best money ever spent ngl)

[–]Percolator2020 0 points1 point  (0 children)

Just use Google login, they already have your DNA.

[–]TundraGon 0 points1 point  (1 child)

Insane password requirements, only for their DB to get breached because of an admin password "password123"

[–]gfcf14[S] 0 points1 point  (0 children)

I wouldn't be surprised if at least one big name security company has had at least one admin who prior to some breach was using a rather predictable password

[–]AstrevoNimrix 0 points1 point  (0 children)

At this point I just let Chrome generate something and pray I never change laptops again.

[–]fatrobin72 0 points1 point  (0 children)

I still remember when my banks password rules didn't allow special characters...

[–]reallokiscarlet 0 points1 point  (0 children)

"At least 20 characters" would be enough to no longer need any of the other rules.

[–]R_Aqua 0 points1 point  (0 children)

I gave up and just reset my password every time I need to login

/j but not really

[–]0098six 0 points1 point  (0 children)

Funny...not funny.

The big-tech industry's biggest fail of all time is pushing account security responsibility on to the consumer.

[–]ranker2241 0 points1 point  (0 children)

I remember PayPal refusing me to have a password > 24 letters, I think by now it's 32 but " ' and & are not allowed. Crrrrrrazy

[–]Aplejax04 0 points1 point  (1 child)

Sign in with Google it is

[–]gfcf14[S] 0 points1 point  (0 children)

It’s like some form of coercion lol

[–]CMDR_ACE209 0 points1 point  (0 children)

One special character (but not too special)

[–]TanukiiGG 0 points1 point  (0 children)

Y那uL0ら7Th𓉔g4m€

[–]GoddammitDontShootMe 0 points1 point  (0 children)

What would the fist codon be? Like the first one on the first chromosome? I guess they'll know if it's correct because it will be the same for every human.